This page shows the candidate plasmid features used by Addgene's plasmid mapping program if full sequence of a plasmid is provided.

oriT_RP4 GAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGAT ACACCAAGGAAAGTCTACA
lpp_promoter TTGACAACATAAAAAACTTTGTGTTATACT
lac_promoter TTTACACTTTATGCTTCCGGCTCGTATGTT
T7_promoter TAATACGACTCACTATAGG
trc_promoter TTGACAATTAATCATCCGGTCCGTATAATCTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACC
tac_promoter TGACAATTAATCATCGGCTCGTATAATGT
Ecoli_CI_promoter TCGAGCTTGACATTGTAGGACTATATTGCTCTAATAAATTT
P5_promoter GCTTTCCTGGCTTTGCTTCCAGATGTATGCT
PL_promoter TCTCACCTACCAAACAATGCCCCCCTGCAAAAAATAAATTCATATAAAAAACATACAGATAACCATCTGCGGTGATAAAT TATCTCTGGCGGTGTTGACATAAATACCACTGGCGGTGATACTGAGCACATCAGCAGGACGCACTGACCACCATGAAGGT GACGCTCTTAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCTTTGGGGTGTGTGATACGAAACGAAGCAT TGG
T3_promoter AATTAACCCTCACTAAAGGG
Sp6_promoter CATTTAGGTGACACTATA
AmpR_promoter TTCAAATATGTATCCGCTCATGAGACAAT
EF1a_promoter CGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAAT TGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGG TGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAA GTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTG CAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTC GCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCG CTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTA AATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCAC ATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGG TGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAA AGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACC CACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACC TCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACT GAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATC TTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGA
TATA_promoter GCCGCCCCGACTGCATCTGCGTGTTCGAATTCGCCAATGACAAGACGCTGGGCGGGGTTTGTGTCATCATAGAACTAAAG ACATGCAAATATATTTCTTCCGGGGACACCGCCAGCAAACGCGAGCAACGGGCCACGGGGATGAAGCAG
CMV_promoter CGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGA TC
CMV2_promoter TAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCT GTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCT
CMV_immearly_promoter ACATTGATTATTGAGTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTA CATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCC ATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCA AGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGA CCTTATGGGACTTTCCTACTTGGCAGTACATCTACGGTTAGTCATCGCTATTACCATAGTGATGCGGTTTTGGCAGTACA TCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGG CACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTG GGAGGTCTATATAAGCAGAGCTTTCTGGCTAACTAGAGAACCCACTGCTTACTGGC
ARA_promoter CTGACGCTTTTTATCGCAACTCTCTACTG
URA3_promoter TAGCTTTTCAATTCAATTCATCATTTTTTTTTTATTCTTTTTTTTGATTTCGGTTTCTTTGAAATTTTTTTGATTCGGTA ATCTCCGAACAGAAGGAAGAACGAAGGAAGGAGCACAGACTTAGATTGGTATATATACGCATATGTAGTGTTGAAGAAAC ATGAAATTGCCCAGTATTCTTAACCCAACTGCACAGAACAAAAACCTGCAGGAAACGAAGATAAAT
NEOKAN_promoter CCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAA
hU6_promoter AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAAT TAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTG CAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGGTTTATAT ATCTTGTGGAAAGGACG
PH_promoter AGTTGCTGATATCATGGAGATAATTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTT TGTAATAAAAAAACCTATAAA
PLtet_promoter TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACATCAGCAGGACGCACTGACC
AOX1_promoter AGATCTAACATCCAAAGACGAAAGGTTGAATGAAACCTTTTTGCCATCCGACATCCACAGGTCCATTCTCACACATAAGT GCCAAACGCAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGACCTCCACTCCTCTTCTCCTCAACACCC ACTTTTGCCATCGAAAAACCAGCCCAGTTATTGGGCTTGATTGGAGCTCGCTCATTCCAATTCCTTCTATTAGGCTACTA ACACCATGACTTTATTAGCCTGTCTATCCTGGCCCCCCTGGCGAGGTCATGTTTGTTTATTTCCGAATGCAACAAGCTCC GCATTACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTCAAATAGTTTCATGTTCCCAAATGGCCCAAA ACTGACAGTTTAAACGCTGTCTTGGAACCTAATATGACAAAAGCGTGATCTCATCCAAGATGAACTAAGTTTGGTTCGTT GAAATGCTAACGGCCAGTTGGTCAAAAAGAAACTTCCAAAAGTCGCCATACCGTTTGTCTTGTTTGGTATTGATTGACGA ATGCTCAAAAATAATCTCATTAATGCTTAGCGCAGTCTCTCTATCGCTTCTGAACCCGGTGGCACCTGTGCCGAAACGCA AATGGGGAAACAACCCGCTTTTTGGATGATTATGCATTGTCCTCCACATTGTATGCTTCCAAGATTCTGGTGGGAATACT GCTGATAGCCTAACGTTCATGATCAAAATTTAACTGTTCTAACCCCTACTTGACAGGCAATATATAAACAGAAGGAAGCT GCCCTGTCTTAAACCTTTTTTTTTATCATCATTATTAGCTTACTTTCATAATTGCGACTGGTTCCAATTGACAAGCTTTT GATTTTAACGACTTTTAACGACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAAACG
EM7_promoter GTGTTGACAATTAATCATCGGCATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACC
GAP_promoter AGATCTTTTTTGTAGAAATGTCTTGGTGTCCTCGTCCAATCAGGTAGCCATCTCTGAAATATCTGGCTCCGTTGCAACTC CGAACGACCTGCTGGCAACGTAAAATTCTCCGGGGTAAAACTTAAATGTGGAGTAATGGAACCAGAAACGTCTCTTCCCT TCTCTCTCCTTCCACCGCCCGTTACCGTCCCTAGGAAATTTTACTCTGCTGGAGAGCTTCTTCTACGGCCCCCTTGCAGC AATGCTCTTCCCAGCATTACGTTGCGGGTAAAACGGAGGTCGTGTACCCGACCTAGCAGCCCAGGGATGGAAAAGTCCCG GCCGTCGCTGGCAATAATAGCGGGCGGACGCATGTCATGAGATTATTGGAAACCACCAGAATCGAATATAAAAGGCGAAC ACCTTTCCCAATTTTGGTTTCTCCTGACCCAAAGACTTTAAATTTAATTTATTTGTCCCTATTTCAATCAATTGAACAAC TAT
yMET25_promoter GAAGATCCGAGGCCTAGCTTCTAATTCTTCCAACATACAATGGGAGTTTGGCCGAGTGGTTTAAGGCGTCAGATTTAGGT GGATTTAACCTCTAAAATCTCTGATATCTTCGGATGCAAGGGTTCGAATCCCTTAGCTCTCATTATTTTTTGCTTTTTCT CTTGAGGTCACATGATCGCAAAATGGCAAATGGCACGTGAAGCTGTCGATATTGGGGAACTGTGGTGGTTGGCAAATGAC TAATTAAGTTAGTCAAGGCGCCATCCTCATGAAAACTGTGTAACATAATAACCGAAGTGTCGAAAAGGTGGCACCTTGTC CAATTGAACACGCTCGATGAAAAAAATAAGATATATATAAGGTTAAGTAAAGCGTCTGTTAGAAAGGAAGTTTTTCCTTT TTCTTGCTCTCTTGTCTTTTCATCTACTATTTCCTTCGTGTAATACAGGGTCGTCAGATACATAGATACAATTCTATTAC CCCCATCCATACA
TEF1_promoter CCCACACACCATAGCTTCAAAATGTTTCTACTCCTTTTTTACTCTTCCAGATTTTCTCGGACTCCGCGCATCGCCGTACC ACTTCAAAACACCCAAGCACAGCATACTAAATTTTCCCTCTTTCTTCCTCTAGGGTGTCGTTAATTACCCGTACTAAAGG TTTGGAAAAGAAAAAAGAGACCGCCTCGTTTCTTTTTCTTCGTCGAAAAAGGCAATAAAAATTTTTATCACGTTTCTTTT TCTTGAAATTTTTTTTTTTAGTTTTTTTCTCTTTCAGTGACCTCCATTGATATTTAAGTTAATAAACGGTCTTCAATTTC TCAAGTTTCAGTTTCATTTTTCTTGTTCTATTACAACTTTTTTTACTTCTTGTTCATTAGAAAGAAAGCATAGCAATCTA ATCTAAGGGCG
hUbC_promoter GATCTGGCCTCCGCGCCGGGTTTTGGCGCCCCCCGCGGGCGCCCCCTCCTCACGGCGAGCGCTGCCACGTCAGACGAAGG GCGCACGAGCGTCCTGATCCTTCCGCCCGGACGCTCAGGACAGCGGCCCGCTGCTCATAAGACTCGGCCTTAGAACCCCA GTATCAGCAGAAGGACATTTTAGGACGGGACTTGGGTGACTCTAGGGCACTGGTTTTCTTTCCAGAGAGCGGAACAGGCG AGGAAAAGTAGTCCCTTCTCGGCGATTCTGCGGAGGGATCTCCGTGGGGCGGTGAACGCCGATGATTATATAAGGACGCG CCGGGTGTGGCACAGCTAGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCGTCACTT GGTGAGTAGCGGGCTGCTGGGCTGGCCGGGGCTTTCGTGGCCGCCGGGCCGCTCGGTGGGACGGAAGCGTGTGGAGAGAC CGCCAAGGGCTGTAGTCTGGGTCCGCGAGCAAGGTTGCCCTGAACTGGGGGTTGGGGGGAGCGCAGCAAAATGGCGGCTG TTCCCGAGTCTTGAATGGAAGACGCTTGTGAGGCGGGCTGTGAGGTCGTTGAAACAAGGTGGGGGGCATGGTGGGCGGCA AGAACCCAAGGTCTTGAGGCCTTCGCTAATGCGGGAAAGCTCTTATTCGGGTGAGATGGGCTGGGGCACCATCTGGGGAC CCTGACGTGAAGTTTGTCACTGACTGGAGAACTCGGTTTGTCGTCTGTTGCGGGGGCGGCAGTTATGGCGGTGCCGTTGG GCAGTGCACCCGTACCTTTGGGAGCGCGCGCCCTCGTCGTGTCGTGACGTCACCCGTTCTGTTGGCTTATAATGCAGGGT GGGGCCACCTGCCGGTAGGTGTGCGGTAGGCTTTTCTCCGTCGCAGGACGCAGGGTTCGGGCCTAGGGTAGGCTCTCCTG AATCGACAGGCGCCGGACCTCTGGTGAGGGGAGGGATAAGTGAGGCGTCAGTTTCTTTGGTCGGTTTTATGTACCTATCT TCTTAAGTAGCTGAAGCTCCGGTTTTGAACTATGCGCTCGGGGTTGGCGAGTGTGTTTTGTGAAGTTTTTTAGGCACCTT TTGAAATGTAATCATTTGGGTCAATATGTAATTTTCAGTGTTAGACTAGTAAATTGTCCGCTAAATTCTGGCCGTTTTTG GCTTTTTTGTTAGAC
EtoL_promoter AAGCCACACTGGACACGAAAAAGTCGAAGGCACTCGCTTCGATCAATGGACAAAGAATCAATCGTTCGTAGGCAACAGAA TGTCGGAAAGTTTGCATTGGATGCGCGGCGGGTCCAACTTGCCGCAAAACTGCGGCGAGTTCAACGTGGTGTCCAGCCTG TTGATGTGCAACAATACGATAATGAAAAATTGATAACGCTTGCACGATTGCAAACATGCACGCTCGGTTGAATAAAAGCT CGCATCGTCGTCGTAAAATTAGTTGTATCAAAGAGCAGCTGCAATTAGAATCACTGCTAAAA
yADH1_promoter CAACTTCTTTTCTTTTTTTTTCTTTTCTCTCTCCCCCGTTGTTGTCTCACCATATCCGCAATGACAAAAAAATGATGGAA GACACTAAAGGAAAAAATTAACGACAAAGACAGCACCAACAGATGTCGTTGTTCCAGAGCTGATGAGGGGTATCTCGAAG CACACGAAACTTTTTCCTTCCTTCATTCACGCACACTACTCTCTAATGAGCAACGGTATACGGCCTTCCTTCCAGTTACT TGAATTTGAAATAAAAAAAAGTTTGCTGTCTTGCTATCAAGTATAAATAGACCTGCAATTATTAATCTTTTGTTTCCTCG TCATTGTTCTCGTTCCCTTTCTTCCTTGTTTCTTTTTCTGCACAATATTTCAAGCTATACCAAGCATACAATCAACT
CaMVd35S_promoter CCTGCAGGTCAACATGGTGGAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGG CAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTG AAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGC CGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGC AAGTGGATTGATGTGATAACATGGTGGAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGAC CAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTT TATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATG CCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCT TCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTC CTCTATATAAGGAAGTTCATTTCATTTGGAGAGGA
TK_promoter CCTGCTTCATCCCCGTGGCCCGTTGCTCGCGTTTGCTGGCGGTGTCCCCGGAAGAAATATATTTGCATGTCTTTAGTTCT ATGATGACACAAACCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAG GTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCAACA GCGTGCCGCAGATCCCGGGGGGC
TK2_promoter AGCAGTGTGGTTTTGCAAGAGGAAGCAAAAAGCCTCTCCACCCAGGCCTGGAATGTTTCCACCCAATGTCGAGCAGTGTG GTTTTGCAAGAGGAAGCAAAAAGCCTCTCCACCCAGGCCTGGAATGTTTCCACCCAATGTCGAGCAAACCCCGCCCAGCG TCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCCAGGTCCACTTCGCATATTAAGGTGACG CGTGTGGCCTCGAACACCGAGCGACCCTGCAGCCAAT
HS_promoter CGCCGGAGTATAAATAGAGGCGCTTCGTCTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAGCG AAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCTGCAGTAAAGTGCAAGTTAAAGTGAATCAATTAAA AGTAACCAGCAACCAAGTAAATCAACTGCAACTACTGAAATCTGCCAAGAAGTAATTATTGAATACAAGAAGACAACTCT GAATACTTTCAAAAGTTACCGAGAAAGAAGAACTCA
MT_promoter TAATTCGTTGCAGGACAGGATGTGGTGCCCGATGTGACTAGCTCTTTGCTGCAGGCCGTCCTATCCTCTGGTTCCGATAA GAGACCCAGAACTCCGGCCCCCCACCGCCCACCGCCACCCCCATACATATGTGGTACGCAAGTAAGAGTGCCTGCGCATG CCCCATGTGCCCCACCAAGAGTTTTGCATCCCATACAAGTCCCCAAAGTGGAGAACCGAACCAATTCTTCGCGGGCAGAA CAAAAGCTTCTGCACACGTCTCCACTCGAATTTGGAGCCGGCCGGCGTGTGCAAAAGAGGTGAATCGAACGAAAGACCCG TGTGTAAAGCCGCGTTTCCAAAATGTATAAAACCGAGAGCATCTGGCCAATGTGCATCAGTTGTGGTCAGCAGCAAAATC AAGTGAATCATCTCAGTGCAACTAAAGG
NMT_promoter AGACAGAATAAGTCATCAGCGGTTGTTTCATTTCCTATATTTTTTTTTTATTTTTTTATTTTTTAATAAGGGAAAATTTA ACGTCTAAGGATACAGAAGATTGTTAGCACATTAAAGTAATAAAGGCTTAAGTAGTAAGTGCCTTAGCATGTTATTGTAT TTCAAAGGACATAATCTAAAATAATAACAATATCGTTTCTCACAAGTTATTCAATTTTCTTTTTTTTTTCTAATAATATC AAGAATGTATTATTTGTTTGACATAAGTCAACTAATTTATTTAATATGCTGGATTAATCTTGCAGACATGTAAATTAACA AGTTTTAGTCAAATAACGTCGAAGTTTCAATGAACTCAAATAATTTCTCTTTTTTTTTATATAACCATAATCTGATTTAT ATTTTCCGCAGGGATCAACTGGAGTTATGACATTTGGATTGGATCACTTATAACCTTGGTCGCCAAATAATACAAAAATC AGCGTTATAAAACAAAGAAGGTTTTTGTTAAGAAATTAATCCTCTTTCTTGATAAGAAAGTTGAACCGAAATTGCAGATA CTGATATATGAAAATAATACCCACAATTTTGGGAATAGCGCAAGCCTCAATTTAAACAATAGGTGAGGACACATGATAAT GACCTCAATGATTGTTAGAAGAAAAGAGCCTCATTACAAAATCGAAAAATGAATGGTTGGGTACAAGTTTCCAAAACATG GTAAAGTGGACTTTGCGTATGAGACGTAAATAGAAAAAAACACTTGTTATATGTTTTCTAGAATTATTGTTGTCTCTTTA TGGTTGGATGATGCAAAATAGTAATTTCGGTTAGTTGCTGTAAAACACCACGAGACAAATAGATATGGATATTTATTAAA TCAGGAAAAACGTAACTCTCGGCTACTGGATGGTTCAGTCACCCAACGATTACTGGGGAGAGAAAACAGGGCAAAAGCAA AGCTTAAAGGAATCCGATTGTCATTCGGCAATGTGCAGCGAAACTAAAAACCGGATAATGGACCTGTTAATCGAAACATT GAAGATATATAAAGGAAGAGGAATCCTGGCATATCATCAATTGAATAAGTTGAATTAATTATTTCAATCTCATTCTCACT TTCTGACTTATAGTCGCT
SV40_promoter TGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCAT TCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTA GTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTT
SV40_promoter GGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGA AAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAAC TCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAG AGGCCGAGGCCGCCTCGGCCTCTGAGCTA
RSV_promoter CTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGA CAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTATCTGAG GGGACTAGGGTGTGTTTAGGCGAAAAGCGGGGCTTCGGTTGTACGCGGTTAGGAGTCCCCTCAGGATATAGTAGTTTCGC TTTTGCATAGGGAGGGGGAAATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACAT GCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCA ACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATA CAATAAACGCCATTTGACCATTCACCACATTGGTGTGCACC
protA_promoter AGCCGAAATAGCGTGATTTTGCGGTTTTAAGCCTTTTACTTCCTGAATAAATCTTTCAGCAAAATATTTATTTTATAAGT TGTAAAACTTACCTTTAAATTTAATTATAAATATAGATTTTAGTATTGCAATACATAATTCGTTATATTATGATGACTTT ACAAATACATACAGGGGGTATTAAT
OpIE1_promoter GCGAAACACGCACGGCGCGCGCACGCAGCTTAGCACAAACGCGTCGTTGCACGCGCCCACCGCTAACCGCAGGCCAATCG GTCGGCCGGCCTCATATCCGCTCACCAGCCGCGTCCTATCGGGCGCGGCTTCCGCGCCCATTTTGAATAAATAAACGATA ACGCCGTTGGTGGCGTGAGGCATGTAAAAGGTTACATCATTATCTTGTTCGCCATCCGGTTGGTATAAATAGACGTTCAT GTTGGTTTTTGTTTCAGTTGCAAGTTGGCTGCGGCGCGCGCAGCACCTTTGC
OpIE2_promoter CATGATGATAAACAATGTATGGTGCTAATGTTGCTTCAACAACAATTCTGTTGAACTGTGTTTTCATGTTTGCCAACAAG CACCTTTATACTCGGTGGCCTCCCCACCACCAACTTTTTTGCACTGCAAAAAAACACGCTTTTGCACGCGGGCCCATACA TAGTACAAACTCTACGTTTCGTAGACTATTTTACATAAATAGTCTACACCGTTGTATACGCTCCAAATACACTACCACAC ATTGAACCTTTTTGCAGTGCAAAAAAGTACGTGTCGGCAGTCACGTAGGCCGGCCTTATCGGGTCGCGTCCTGTCACGTA CGAATCACATTATCGGACCGGACGAGTGTTGTCTTATCGTGACAGGACGCCAGCTTCCTGTGTTGCTAACCGCAGCCGGA CGCAACTCCTTATCGGAACAGGACGCGCCTCCATATCAGCCGCGCGTTATCTCATGCGCGTGACCGGACACGAGGCGCCC GTCCCGCTTATCGCGCCTATAAATACAGCCCGCAACGATCTGGTAAACACAGTTGAACAGCATCTGTT
GAL1_promoter ACGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTCCGAAGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCG TTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGTTATGAA GAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATGAACGAATCAAATTAACAACCATAGGATGATAATGCGA TTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGCAA AAACTGCATAACCACTTTAACTAATACTTTCAACATTTTCGGTTTGTATTACTTCTTATTCAAATGTAATAAAAGTATCA ACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACC
cBA_promoter TGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATT TTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCG GGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGC GGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGG
lacO GGGAATTGTGAGCGGATAACAATTCCCC
tetO TCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGA
araO2 AAACCAATTGTCCATA
araO1 CGGCAGAAAAGT
EGRE AGATCTCGGCCGCATATTAAGTGCATTGTTCTCGATACCGCTAAGTGCATTGTTCTCGTTAGCTCGATGGACAAGTGCAT TGTTCTCTTGCTGAAAGCTCGATGGACAAGTGCATTGTTCTCTTGCTGAAAGCTCGATGGACAAGTGCATTGTTCTCTTG CTGAAAGCTCAGTAC
HSE CTAGAATGTTCTAGATCTAGAACATTCTAGCTAGAATGTTCTAGA
ISRE GAAACTGAAACTGAAACTGAAACTGAAACTGAAACTGAAACTGAAACTGAAACTGAAACTA
cMyc_DBE CACGTGCACGTGCACGTGCACGTGCACGTGCACGTG
NFAT_RE GGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATA CAGAAGGCGT
p53_RE ACGTTTGCCTTGCCTGGACTTGCCTGGCCTTGCCTTGGACATGCCCGGGCTGTC
RAR_DBD AGGTCACCAGGAGGTCAAGGTCACCAGGAGGTCA
GRE CTAGCGGTACATTTTGTTCTAGAACAAAATGTACCGGTACATTTT
RbRE CCCGCGCGCCACCCCTCTGGCGCCACCGTGCCCGCGCGCCACCCCTCTGGCGCCACCGTG
SRE GATGTCCATATTAGGACATCGATGTCCGAATATGGACATCGATGTCCATATTAGGACATC
STAT3_DBS TGCTTCCCGAACGTTGCTTCCCGAACGTTGCTTCCCGAACGTTGCTTCCCGAACGT
TRE GTAAGGTCACAGGAGGTCACTCGCGTAAGGTCACAGGAGGTCACTCGC
CRE GCACCAGACAGTGACGTCAGCTGCCAGATCCCATGGCCGTCATACTGTGACGTCTTTCAGACACCCCATTGACGTCAATG GGAGAAC
RRE AGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCA GACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTC ACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCT
TetR TCTAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCG TAAACTCGCCCAGAAGCTAGGTGTAGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCT TAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAAT AACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAA ACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCA GCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCT ACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATT CGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCCGGACTCAGATCCA
ATF_AD CCATGAAATTCAAGTTACATGTGAATTCTGCCAGGCAATACAAGGACCTGTGGAATATGAGTGATGACAAACCCTTTCTA TGTACTGCGCCTGGATGTGGCCAGCGTTTTACCAACGAGGATCATTTGGCTGTCCATAAACATAAACATGAGATGACACT GAAATTTGGTCCAGCACGTAATGACAGTGTCATTGTGGCTGATCAGACCCCAACACCAACAAGATTCTTGAAAAACTGTG AAGAAGTGGGTTTGTTTAATGAGTTGGCGAGTCCATTTGAGAATGAATTC
CREB_AD ATGACCATGGAATCTGGAGCCGAGAACCAGCAGAGTGGAGATGCAGCTGTAACAGAAGCTGAAAACCAACAAATGACAGT TCAAGCCCAGCCACAGATTGCCACATTAGCCCAGGTATCTATGCCAGCAGCTCATGCAACATCATCTGCTCCCACCGTAA CTCTAGTACAGCTGCCCAATGGGCAGACAGTTCAAGTCCATGGAGTCATTCAGGCGGCCCAGCCATCAGTTATTCAGTCT CCACAAGTCCAAACAGTTCAGATTTCAACTATTGCAGAAAGTGAAGATTCACAGGAGTCAGTGGATAGTGTAACTGATTC CCAAAAGCGAAGGGAAATTCTTTCAAGGAGGCCTTCCTACAGGAAAATTTTGAATGACTTATCTTCTGATGCACCAGGAG TGCCAAGGATTGAAGAAGAGAAGTCTGAAGAGGAGACTTCAGCACCTGCCATCACCACTGTAACGGTGCCAACTCCAATT TACCAAACTAGCAGTGGACAGTATATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACCGATGGGGT ACAGGGCCTGCAAACATTAACCATGACCAATGCAGCAGCCACTCAGCCGGGTACTACCATTCTACAGTATGCACAGACCA CTGATGGACAGCAGATCTTAGTGCCCAGCAACCAAGTTGTTGTTCAAGCTGCCTCTGGAGACGTACAAACATACCAGATT CGCACAGCACCCACTAGCACTATTGCCCCTGGAGTTGTTATGGCATCCTCCCCAGCACTTCCTACACAGCCTGCTGAAGA A
ELK_AD TCTCCCAGCCGCAGAAGGGCCGGAAGCCCCGGGACCTAGAGCTTCCACTCAGCCCGAGCCTGCTAGGTGGGCCGGGACCC GAACGGACCCCAGGATCGGGAAGTGGCTCCGGCCTCCAGGCTCCGGGGCCGGCGCTGACCCCATCCCTGCTTCCTACGCA TACATTGACCCCGGTGCTGCTGACACCCAGCTCGCTGCCTCCTAGCATTCACTTCTGGAGCACCCTGAGTCCCATTGCGC CCCGTAGCCCGGCCAAGCTCTCCTTCCAGTTTCCATCCAGTGGCAGCGCCCAGGTGCACATCCCTTCTATCAGCGTGGAT GGCCTCTCGACCCCCGTGGTGCTCTCCCCAGGGCCCCAGAAGCCATGAGAATTC
Jun_AD TCCATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTA TGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACC TCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTG ATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGA GCAGGAGGGGTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGG CGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTC AGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGG GGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCC AGCAGATGCCCGTGCAGCACCCGCGGCGGCAG
rrnB_ATS CGCCGCTGAGAAAAAGCGAAGCGGCACTGCTCTTTAACAATTTATCAGACAATCTGTGTGGGCACTCGAC
T710RBSL GAAGGAGATATACCATGGCTAGCATGACTGGTGGACAGCAAATGGGT
ERE AGGTCACAGTGACCTAGGTCACAGTGACCTA
TE5pUTR CCTCGAGAATTCTCAACACAACATATACAAAACAAACGAATCTCAAGCAATCAAGCATTCTACTTCTATTGCAGCAATTT AAATCATTTCTTTTAAAGCAAAAGCAATTTTCTGAAAATTTTCACCATTTACGAACGATAGC
SV40_enhancer GATCTGAACCATGGAGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATG GTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCTGGTTGCTGA CTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCCTAACTGACACACATTCC ACAGCA
Tn3R CTCAAAGATGCAGGGGTAAAAGCTAACCGCATCTTTACCGACAAGGCATCCGGCAGTTCAACAGATCGGGAAGGGCTGGA TTTGCTGAGGATGAAGGTGGAGGAAGGTGATGTCATTCTGGTGAAGAAGCTCGACCGTCTTGGCCGCGACACCGCCGACA TGATCCAACTGATAAAAGAGTTTGATGCTCAGGGTGTAGCGGTTCGGTTTATTGACGACGGGATCAGTACCGACGGTGAT ATGGGGCAAATGGTGGTCACCATCCTGTCGGCTGTGGCACAGGCTGAACGCCGGAGGATCCTAGAGCGCACGAATGAGGG CCGACAGGAAGCAAAGCTGAAAGGAATCAAATTTGGCCGCAGGCGTACCGTGGACAGGAACGTCGTGCTGACGCTTCATC AGAAGGGCACTGGTGCAACGGAAATTGCTCATCAGCTCAGTATTGCCCGCTCCACGGTTTATAAAATTCTTGAAGACGAA AGGGCCTCGTG
E2F_DBS CTTGGCGGGAGATAGAACTTGGCGGGAGATAGGAACTTGGCGGGAGATAGGAACTTGGCGGGAGATAGGAA
GAS AGGTTTCCGGGAAAGCAGTAGGTTTCCGGGAAAGC
copG_TR ATGAAAAAAAGATTGACGATAACACTCAGTGAATCGGTGCTTGAAAATCTTGAAAAAATGGCAAAAGAGATGGGGTTGTC AAAATCTGCACTGATTTCAGTTGCCTTGGAAAACTACAAGAAAGGTCAAGTAAAATAA
TB AATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGAATCGATAGTACTAACATACGCTCTCCATCA AAACAAAACGAAACAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCT
AP1 TGACTAATGACTAATGACTAATGACTAATGACTAATGACTAA
TRE CTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGT GAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAA AAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAG AGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAG
cI857_LR ATGAGCACAAAAAAGAAACCATTAACACAAGAGCAGCTTGAGGACGCACGTCGCCTTAAAGCAATTTATGAAAAAAAGAA AAATGAACTTGGCTTATCCCAGGAATCTGTCGCAGACAAGATGGGGATGGGGCAGTCAGGCGTTGGTGCTTTATTTAATG GCATCAATGCATTAAATGCTTATAACGCCGCATTGCTTACAAAAATTCTCAAAGTTAGCGTTGAAGAATTTAGCCCTTCA ATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGTATGAGTACCCTGTTTT TTCTCATGTTCAGGCAGGGATGTTCTCACCTAAGCTTAGAACCTTTACCAAAGGTGATGCGGAGAGATGGGTAAGCACAA CCAAAAAAGCCAGTGATTCTGCATTCTGGCTTGAGGTTGAAGGTAATTCCATGACCGCACCAACAGGCTCCAAGCCAAGC TTTCCTGACGGAATGTTAATTCTCGTTGACCCTGAGCAGGCTGTTGAGCCAGGTGATTTCTGCATAGCCAGACTTGGGGG TGATGAGTTTACCTTCAAGAAACTGATCAGGGATAGCGGTCAGGTGTTTTTACAACCACTAAACCCACAGTACCCAATGA TCCCATGCAATGAGAGTTGTTCCGTTGTGGGGAAAGTTATCGCTAGTCAGTGGCCTGAAGAGACGTTTGGCTGA
lacI GTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGT GAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACC GCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCG CAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGT CGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACC AGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAAC AGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCT GTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTC AGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATC GTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGT TGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAAC AGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAG CTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGA TTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA
29kD_rep ATGGCGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATCGTCCAGTCAAACGACCTCACTGAGGC GGCATATAGTCTCTCCCGGGATCAAAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCACCCTAC AGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCTGAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAG GATATACGGCAGGCATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGGATGCCGGCGATGAAAA AGGCTATGAATCTTTTCCTTGGTTTATCAAACGTGCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCAT ATCTCATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTAGTGAAACAAAAGAAATCACCAATCCG TATGCCATGCGTTTATACGAATCCCTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAATCGACTG GATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGCCTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTA ATGAGATCAACAGCAGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGACGACTCATATCGTATTT TCCTTCCGCGATATCACTTCCATGACGACAGGATAG
IRES GCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTA TTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGG TCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGAC AAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGT GTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCT CTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGT GCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGA AAAACACGATGATAATATGGCCACA
B42_AD ATGGGTGCTCCTCCAAAAAAGAAGAGAAAGGTAGCTGGTATCAATAAAGATATCGAGGAGTGCAATGCCATCATTGAGCA GTTTATCGACTACCTGCGCACCGGACAGGAGATGCCGATGGAAATGGCGGATCAGGCGATTAACGTGGTGCCGGGCATGA CGCCGAAAACCATTCTTCACGCCGGGCCGCCGATCCAGCCTGACTGGCTGAAATCGAATGGTTTTCATGAAATTGAAGCG GATGTTAACGATACCAGCCTCTTGCTGAGTGGAGATGCCTCCT
3MoMuLV_LTR AATGAAAGACCCCACCTGTAGGTTTGGCAAGCTAGCTTAAGTAACGCCATTTTGCAAGGCATGGAAAAATACATAACTGA GAATAGAGAAGTTCAGATCAAGGTCAGGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGT TCCTGCCCCGGCTCAGGGCCAAGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTG CCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTC CAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGC GCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCCTCACTCGGGGCGCCAGTCCTCCGATTGACTGAGTCGCCCG GGTACCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGA GTGATTGACTACCCGTCAGCGGGGGTCTTTCATT
5MoMuLV_LTR TTTGAAAGACCCCACCCGTAGGTGGCAAGCTAGCTTAAGTAACGCCACTTTGCAAGGCATGGAAAAATACATAACTGAGA ATAGAAAAGTTCAGATCAAGGTCAGGAACAAAGAAACAGCTGAATACCAAACAGGATATCTGTGGTAAGCGGTTCCTGCC CCGGCTCAGGGCCAAGAACAGATGAGACAGCTGAGTGATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGG CTCGGGGCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGTGAATCATCAGATGTTTCCAGGGT GCCCCAAGGACCTGAAAATGACCCTGTACCTTATTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTC CGCTCTCCGAGCTCAATAAAAGAGCCCACAACCCCTCACTCGGCGCGCCAGTCTTCCGATAGACTGCGTCGCCCGGGTAC CCGTATTCCCAATAAAGCCTCTTGCTGTTTGCATCCGAATCGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGA TTGACTACCCACGACGGGGGTCTTTCATT
CE_CA_oriR_RepA AGTGATCTCCTCAGAATAATCCGGCCTGCGCCGGAGGCATCCGCACGCCTGAAGCCCGCCGGTGCACAAAAAAACAGCGT CGCATGCAAAAAACAATCTCATCATCCACCTTCTGGAGCATCCGATTCCCCCTGTTTTTAATACAAAATACGCCTCAGCG ACGGGGAATTT
repA GTGACTGATCTTCACCAAACGTATTACCGCCAGGTAAAGAACCCGAATCCGGTGTTCACTCCCCGTGAAGGTGCCGGAAC GCCGAAGTTCCGCGAAAAACCGATGGAAAAGGCGGTGGGCCTCACCTCCCGTTTTGATTTCGCCATTCATGTGGCGCATG CCCGTTCCCGTGGTCTGCGTCGGCGCATGCCACCGGTGCTGCGTCGACGGGCTATTGATGCGCTGCTGCAGGGGCTGTGT TTCCACTATGACCCGCTGGCCAACCGCGTCCAGTGTTCCATCACCACACTGGCCATTGAGTGCGGACTGGCGACAGAGTC CGGTGCAGGAAAACTCTCCATCACCCGTGCCACCCGGGCCCTGACGTTCCTGTCAGAGCTGGGACTGATTACCTACCAGA CGGAATATGACCCGCTTATCGGGTGCTACATTCCGACCGACATCACGTTCACACTGGCTCTGTTTGCTGCCCTTGATGTG TCTGAGGATGCAGTGGCAGCTGCGCGCCGCAGTCGTGTTGAATGGGAAAACAAACAGCGCAAAAAGCAGGGGCTGGATAC CCTGGGTATGGATGAGCTGATAGCGAAAGCCTGGCGTTTTGTGCGTGAGCGTTTCCGCAGTTACCAGACAGAGCTTCAGT CCCGTGGAATAAAACGTGCCCGTGCGCGTCGTGATGCGAACAGAGAACGTCAGGATATCGTCACCCTAGTGAAACGGCAG CTGACGCGTGAAATCTCGGAAGGACGCTTCACTGCTAATGGTGAGGCGGTAAAACGCGAAGTGGAGCGTCGTGTGAAGGA GCGCATGATTCTGTCACGTAACCGCAATTACAGCCGGCTGGCCACAGCTTCTCCCTGA
tap ATGCCCGGAAAAGTTCAAGACTTCTTTCTGTGCTCGCTCCTTCTGCGCATTGTAAGTGCAGGATGGTGTGA
tetR_TA ATGTCTAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAAC CCGTAAACTCGCCCAGAAGCTAGGTGTAGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACG CCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGT AATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGA AAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCAC TCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACA CCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTT ATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCCGCGTACAGCCGCGCGCGTA CGAAAAACAATTACGGGTCTACCATCGAGGGCCTGCTCGATCTCCCGGACGACGACGCCCCCGAAGAGGCGGGGCTGGCG GCTCCGCGCCTGTCCTTTCTCCCCGCGGGACACACGCGCAGACTGTCGACGGCCCCCCCGACCGATGTCAGCCTGGGGGA CGAGCTCCACTTAGACGGCGAGGACGTGGCGATGGCGCATGCCGACGCGCTAGACGATTTCGATCTGGACATGTTGGGGG ACGGGGATTCCCCGGGTCCGGGATTTACCCCCCACGACTCCGCCCCCTACGGCGCTCTGGATATGGCCGACTTCGAGTTT GAGCAGATGTTTACCGATGCCCTTGGAATTGACGAGTACGGTGGGTAG
RNAseIII_PS ACTATAGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCTTCCGGTTAATACGACCGGG
CopA ATAGCTGAATTGTTGGCTATACGGTTTAAGTGGGCCCCGGTAATCTTTTCGTACTCGCCAAAGTTGAAGAAGATTATCGG GGTTTTTGCTT
CopB ATGTCGCAGACAGAAAATGCAGTGACTTCCTCATTGAGTCAAAAGCGGTTTGTGCGCAGAGGTAAGCCTATGACTGACTC TGAGAAACAAATGGCCGCTGTTGCAAGAAAACGTCTTACACACAAAGAGATAAAAGTTTTTGTCAAAAATCCTCTGAAAG ATCGATCTCATGGTTGAGTACTGCGAGAGAGAGGGGATAACACAGGCTCAGTTCGTTGAGAAAATCATCAAAGATGAACT GCAGAGACTGGATATACTAAAGTAA
repB ATGGCTAAAGAAAAAGCAAGATACTTCACTTTTTTACTCTATCCTGAGTCAATCCCTAGTGATTGGGAATTGAAATTAGA ATTGCTGGGCGTACCTATTGCAGTCAGCCCTTTGCATGATAGAGACAAGAGTGATGTTGAGGGACAACAATATAAAAAAC CGCACTATCATGTGATTTATGTTTCAAAAAATCCAGTCACGGCAGATAGTGTGAGAATGAAAATTAAGAGGTCACTTGGA GATAATAGCGTTGCTCTAGTTCAGATAATTAGAACTAGCATTGAGAACACGTATTTATATCTTACGCATGAATCAAAGGA CGCTATCGAAAAGAAAAAGCACGTCTATGATAAGGCTGACATAACTTTGCTTAGTAACTTTGATATAGACCGTTATATAA CGCTTGACGTCGAAGAGAAAGACGATATGCTCAATGAGGTTTGTGACCTTATTGATGAGTATGATATTGCAAATATGCGT GAATTGAGACGTTTTATTAAACTTCATGGGGCTGAACATGGTTTACCTAGTATCAAAATTATAAATTCAGTTTTACGTTC GCATACTGGGTTAATACGTCTGTATTTTGATGCTGTCTATCAAGAACGTAAGTATGGCAGTAATATCCCTAATGTTAATC AAGAGACAGGCGAGATTTTAAGTGAGGATAGCGATGACTGA
NFKB_RE GCTAGCGGGAATTTCCGGGAATTTCCGGGAATTTCCGGGAATTTCCA
GK ATGAGTCTGAAAGAAAAAACACAATCTCTGTTTGCCAACGCATTTGGCTACCCTGCCACTCACACCATTCAGGCGCCTGG CCGCGTGAATTTGATTGGTGAACACACCGACTACAACGACGGTTTCGTTCTGCCCTGCGCGATTGATTATCAAACCGTGA TCAGTTGTGCACCACGCGATGACCGTAAAGTTCGCGTGATGGCAGCCGATTATGAAAATCAGCTCGACGAGTTTTCCCTC GATGCGCCCATTGTCGCACATGAAAACTATCAATGGGCTAACTACGTTCGTGGCGTGGTGAAACATCTGCAACTGCGTAA CAACAGCTTCGGCGGCGTGGACATGGTTGATCACGGCAATGTGCCGCAGGGTGCCGGGTTAAGTTCTTCCGCTTCACTGG AAGTCGCGGTCGGAACCGTATTGCAGCAGCTTTATCATCTGCCGCTGGACGGCGCACAAATCGCGCTTAACGGTCAGGAA GCAGAAAACCAGTTTGTAGGCTGTAACTGCGGGATCATGGATCAGCTAATTTCCGCGCTCGGCAAGAAAGATCATGCCTT GCTGATCGATTGCCGCTCACTGGGGACCAAAGCAGTTTCCATGCCCAAAGGTGTGGCTGTCGTCATCATCAACAGTAACT TCAAACGTACCCTGGTTGGCAGCGAATACAACACCCGTCGTGAACAGTGCGAAACCGGTGCGCGTTTCTTCCAGCAGCCA GCCCTGCGTGATGTCACCATTGAAGAGTTCAACGCTGTTGCGCATGAACTGGACCCGATCGTGGCAAAACGCGTGCGTCA TATACTGACTGAAAACGCCCGCACCGTTGAAGCTGCCAGCGCGCTGGAGCAAGGCGACCTGAAACGTATGGGCGAGTTGA TGGCGGAGTCTCATGCCTCTATGCGCGATGATTTCGAAATCACCGTGCCGCAAATTGACACTCTGGTAGAAATCGTCAAA GCTGTGATTGGCGACAAAGGTGGCGTACGCATGACCGGCGGCGGATTTGGCGGCTGTATCGTCGCGCTGATCCCGGAAGA GCTGGTGCCTGCCGTACAGCAACGTGTCGCTGAACAATATGAAGCAAAAACAGGTATTAAAGAGACTTTTTACGTTTGTA AACCATCACAAGGAGCAGGACAGTGCTGA
HIS3_3UTR_terminator TGACACCGATTATTTAAAGCTGCAGCATACGATATATATACATGTGTATATATGTATACCTATGAATGTCAGTAAGTATG TATACGAACAGTATGATACTGAAGATGACAAGGTAATGCATCATTCTATACGTGTCATTCTGAACGAGGCGCGCTTTCCT TTTTTCTTTTTGCTTTTTCTTTTTTTTTCTCTTGAACTCGAGAAAAAAAATATAAAAGAGATGGAGGAACGGGAAAAAGT TAGTTGTGGTGATAGGTGGCAAGTGGTATTCCGTAAGAACAACAAGAAAAGCATTTCATATTATGGCTGAACTGAGCGAA CAAGTGCAAAATTTAAGCATCAACGACAACAACGAGAATGGTTATGTTCCTCCTCACTTAAGAGGAAAACCAAGAAGTGC CAGAAATAACATGAGCAACTACAATAACAACAACGGCGGCTACAACGGTGGCCGTGGCGGTGGCAGCTTCTTTAGCAACA ACCGTCGTGGTGGTTACGGCAACGGTGGTTTCTTCGGTGGAAACAACGGTGGCAGCAGATCTAACGGCCGTTCTGGTGGT AGATGGATCGATGGCAAACATGTCCCAGCTCCAAGAAACGAAAAGGCCGAGATCGCCATATTTGGTGTCCCCGAG
T4_32_terminator TTGGGGACCCTAGAGGTCCCCTTTTTTATTTT
stem_loop_early_T7_terminator GGCTCACCTTCGGGTGGGCC
T7_terminator ATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGA
T7_terminator CTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCT AAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGAT
OpIE2_terminator ATCTTAGTTTGTATTGTCATGTTTTAATACAATATGTTATGTTTAAATATGTTTTTAATAAATTTTATAAAATAATTTCA ACTTTTATTGTAACAACATTGTCCATTTACACACTCCTTTCAAGCGCGTG
trpA_terminator AGCCCGCCTAATGAGCGGGCTTTTTTTT
rrnB_T1_terminator ATAAAACGAAAGGCTCAGTCGGAAGACTGGGCCTTTCGTTTTAT
rrnB_T2_terminator AGAAGGCCATCCTGACGGATGGCCTTTT
rrnB_terminator TGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGT GTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTT
fd_terminator ATACAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTTGGAGATTTTCAACGT
fd_terminator TAAACCGATACAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTTGGAG
yADH1_terminator GCGAATTTCTTATGATTTATGATTTTTATTATTAAATAAGTTATAAAAAAAATAAGTGTATACAAATTTTAAAGTGACTC TTAGGTTTTAAAACGAAAATTCTTGTTCTTGAGTAACTCTTTCCTGTAGGTCAGGTTGCTTTCTCAGGTATAGCATGAGG TCGCTCTTATTGACCACACCTCTACCGGCATG
yADH2_terminator AAGCTTTGGACTTCTTCGCCAGAGGTTTGGTCAAGTCTCCAATCAAGGTTGTCGGCTTGTCTACCTTGCCAGAAATTTAC GAAAAGATGGAAAAGGGTCAAATCGTTGGTAGATACGTTGTTGACACTTCTAAATAAGCGAATTTCTTATGATTTATGAT TTTTATTATTAAATAAGTTATAAAAAAAATAAGTGTATACAAATTTTAAAGTGACTCTTAGGTTTTAAAACGAAAATTCT TATTCTTGAGTAACTCTTTCCTGTAGGTCAGGTTGCTTTCTCAGGTATAGCATGAGGTCGCTCTTATTGACCACACCTCT ACCGGCC
CaMV_35S_terminator AGTCCGCAAAAATCACCAGTCTCTCTCTACAAATCTATCTCTCTCTATTTTTCTCCAGAATAATGTGTGAGTAGTTCCCA GATAAGGGAATTAGGGTTCTTATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGT AAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGTGA
SV40_PA_terminator TGATCATAATCAAGCCATATCACATCTGTAGAGGTTTACTTGCTTTAAAAAACCTCCACACCTCCCCCTGAACCTGAAAC ATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAAT TTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGAT CTGC
SV40_PA_terminator CCATGGCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATT TTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCTC
nmt1_2_terminator AAGGAATGTCTCCCTTGCCAGTACTGCTAGGGTTTTTCTTTCAAACTATGGAAGCCCATTCAAGCTGCATATTACGATTT TGTTTTTCGCTTTTAGAAAGTGGTTTAGATGAGATAATAGAAAAATTCTTGATCTCCGACAACGAGTACTTTTATTTTTT TTGCTAATCACTTTACTCAATATTAGCTCGAAATCGTAGAAACGTAGACGGGTGCGGGATACCGAGTGGTGTAGTTAAGA ATCTTTATAAACCACGTCATATTGATTGTATTAATTGCATTTAAACCGGTTAAAAAAACTATTGATAGTATAATCGTAAG GACACATGCTTTAAATTGGATGCATCATATACATCTA
AOX1_terminator GTTTTAGCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAG AGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGG ATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGT AGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGA GACCTTCGTTTGTGCGGATCC
AOX1_terminator CCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCATTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTC AGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTT TGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTT GGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCG TTTGTGCAAGCTT
up_PA_terminator AATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGAATCGATAGTACTAACATACGCTCTCCATCA AAACAAAACGAAACAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCT
bGH_PA_terminator CGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCC ACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGG GCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG
rb_glob_PA_terminator TTCACTCCTCAGGTGCAGGCTGCCTATCAGAAGGTGGTGGCTGGTGTGGCCAATGCCCTGGCTCACAAATACCACTGAGA TCTTTTTCCCTCTGCCAAAAATTATGGGGACATCATGAAGCCCCTTGAGCATCTGACTTCTGGCTAATAAAGGAAATTTA TTTTCATTGCAATAGTGTGTTGGAATTTTTTGTGTCTCTCACTCGGAAGGACATATGGGAGGGCAAATCATTTAAAACAT CAGAATGAGTATTTGGTTTAGAGTTTGGCAACATATGCCCATATGCTGGCTGCCATGAACAAAGGTTGGCTATAAAGAGG TCATCAGTATATGAAACAGCCCCCTGCTGTCCATTCCTTATTCCATAGAAAAGCCTTGACTTGAGGTTAGATTTTTTTTA TATTTTGTTTTGTGTTATTTTTTTCTTTAACATCCCTAAAATTTTCCTTACATGTTTTACTAGCCAGATTTTTCCTCCTC TCCTGACTACTCCCAGTCATAGCTGTCCCTCTTCTCTTATGGAGATC
ura4_terminator TTCTGTAAAATTTTTTTGGTTGGTTATTGAAAAAGTCGATGCCTTGTTTGCGTTTGTTTTCCTAGGCGTTTTATGTCAGA AGGCATTTAGAATTAGTATACAAGTACTCTTTGGTAAAATTTTATGTAGCGACTAAAATATTAACTATTATAGATAAACA CCTTGGGAATAAAAAGTAATTTGCTATAGTAATTTATTAAACATGCTCCTACAACATTACCACAATCTTTTCTCTTGGAT TGACATTGAATAAGAAAAGAGTGAATTTTTTTAGACTTGTAATGATAACTATGTACAAAGCCAATGAAAGATGTATGTAG ATGAATGTAAAATACCATGTAGACAAACAAGATAAAACTTGGTTATAAACATTGGTGTTGGAACAGAATAAATTAGATGT CAAAAAGTTTCGTCAATATCACAAGCT
yPGK_terminator TCTCCCATGTCTCTACTGGTGGTGGTGCTTCTTTGGAATTATTGGAAGGTAAGGAATTGCCAGGTGTTGCTTTCTTATCC GAAAAGAAATAAATTGAATTGAATTGAAATCGATAGATCAATTTTTTTCTTTTCTCTTTCCCCATCCTTTACGCTAAAAT AATAGTTTATTTTATTTTTTGAATATTTTTTATTTATATACGTATATATAGACTATTATTTATCTTTTAATGATTATTAA GATTTTTATTAAAAAAAAATTCGCTCCTCTTTTAATGCCTTTATGCAGTTTTTTTTTCCCATTCGATATTTCTATGTTCG GGTTCAGCGTATTTTAAGTTTAATAACTCGAAAATTCTGCGTTCGTTAAAGCTAGGCCTCGGATCTTC
synth_PA_terminator AATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTG
hGH_PA_terminator ACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTC CTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAG CAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTT GGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGC ATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTA ATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTT
TK_PA_terminator GGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAA ACGCACGGGTGTTGGGTCGTTTGTTCATAAACGCGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGAC CCCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCA GCCAACGTCGGGGCGGCAGGCCCTGCCATAG
CYC1_terminator CACGTCCGACGGCGGCCCACGGGTCCCAGGCCTCGGAGATCCGTCCCCCTTTTCCTTTGTCGATATCATGTAATTAGTTA TGTCACGCTTACATTCACGCCCTCCCCCCACATCCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTC CCTATTTATTTTTTTATAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAGACG CGTGTACGCATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGCTCGAAGGCTTTAATTTGCAAGCT
Ampicillin ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAAC GCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGA TCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCC CGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCAC AGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCA ACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTT GATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAAC GTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAG TTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCT CGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAAC TATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAA
tet TCAGGTCGAGGTGGCCCGGCTCCATGCACCGCGACGCAACGCGGGGAGGCAGACAAGGTATAGGGCGGCGCCTACAATCC ATGCCAACCCGTTCCATGTGCTCGCCGAGGCGGCATAAATCGCCGTGACGATCAGCGGTCCAATGATCGAAGTTAGGCTG GTAAGAGCCGCGAGCGATCCTTGAAGCTGTCCCTGATGGTCGTCATCTACCTGCCTGGACAGCATGGCCTGCAACGCGGG CATCCCGATGCCGCCGGAAGCGAGAAGAATCATAATGGGGAAGGCCATCCAGCCTCGCGTCGCGAACGCCAGCAAGACGT AGCCCAGCGCGTCGGCCGCCATGCCGGCGATAATGGCCTGCTTCTCGCCGAAACGTTTGGTGGCGGGACCAGTGACGAAG GCTTGAGCGAGGGCGTGCAAGATTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAGCGGTCCTC GCCGAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTACGAGTTGCATGATAAAGAAGACAGTCATAAGTGCGGCGACGA TAGTCATGCCCCGCGCCCACCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATGGGTCGGCGCTCTCCCTTATGC GACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGCAAGGAATGGTGCATGTAAGGA GATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGC GAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACG ATGCGTCCGGCGTAGAGAATCCACAGGACGGGTGTGGTCGCCATGATCGCGTAGTCGATAGTGGCTCCAAGTAGCGAAGC GAGCAGGACTGGGCGGCGGCCAAAGCGGTCGGACAGTGCTCCGAGAACGGGTGCGCATAGAAATTGCATCAACGCATATA GCGCTAGCAGCACGCCATAGTGACTGGCGATGCTGTCGGAATGGACGATATCCCGCAAGAGGCCCGGCAGTACCGGCATA ACCAAGCCTATGCCTACAGCATCCAGGGTGACGGTGCCGAGGATGACGATGAGCGCATTGTTAGATTTCAT
gent ATGTTACGCAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGGTGGCTCAAGTATGGGCATCAT TCGCACATGTAGGCTCGGCCCTGACCAAGTCAAATCCATGCGGGCTGCTCTTGATCTTTTCGGTCGTGAGTTCGGAGACG TAGCCACCTACTCCCAACATCAGCCGGACTCCGATTACCTCGGGAACTTGCTCCGTAGTAAGACATTCATCGCGCTTGCT GCCTTCGACCAAGAAGCGGTTGTTGGCGCTCTCGCGGCTTACGTTCTGCCCAGGTTTGAGCAGCCGCGTAGTGAGATCTA TATCTATGATCTCGCAGTCTCCGGCGAGCACCGGAGGCAGGGCATTGCCACCGCGCTCATCAATCTCCTCAAGCATGAGG CCAACGCGCTTGGTGCTTATGTGATCTACGTGCAAGCAGATTACGGTGACGATCCCGCAGTGGCTCTCTATACAAAGTTG GGCATACGGGAAGAAGTGATGCACTTTGATATCGACCCAAGTACCGCCACCTAA
bleo ATGGCCAAGTTGACCAGTGCCGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCTGGACCGACCGGCT CGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCCGGTGTGGTCCGGGACGACGTGACCCTGTTCATCAGCGCGGTCC AGGACCAGGTGGTGCCGGACAACACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACGAGCTGTACGCCGAGTGGTCGGAG GTCGTGTCCACGAACTTCCGGGACGCCTCCGGGCCGGCCATGACCGAGATCGGCGAGCAGCCGTGGGGGCGGGAGTTCGC CCTGCGCGACCCGGCCGGCAACTGCGTGCACTTCGTGGCCGAGGAGCAGGAC
zeo TTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATGTGAGG AGGGCCACCATGGCCAAGTTGACCAGTGCCGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCTGGAC CGACCGGCTCGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCCGGTGTGGTCCGGGACGACGTGACCCTGTTCATCA GCGCGGTCCAGGACCAGGTGGTGCCGGACAACACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACGAGCTGTACGCCGAG TGGTCGGAGGTCGTGTCCACGAACTTCCGGGACGCCTCCGGGCCGGCCATGACCGAGATCGGCGAGCAGCCGTGGGGGCG GGAGTTCGCCCTGCGCGACCCGGCCGGCAACTGCGTGCACTTCGTGGCCGAGGAGCAGGACTGA
puro ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCCGGGCCGTACGCACCCTCGCCGCCGCGTT CGCCGACTACCCCGCCACGCGCCACACCGTCGACCCGGACCGCCACATCGAGCGGGTCACCCGAGCTGCAAGAACTCTTC CTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGCCACACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGA GAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGAACGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGC AACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGAC CACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCT GGAGACCTCCGCGCCCCGCAACCTCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGTGCCCGAAGGA CCGCGCGACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA
KanR1 ATGGCTAAAATGAGAATATCACCGGAATTGAAAAAACTGATCGAAAAATACCGCTGCGTAAAAGATACGGAAGGAATGTC TCCTGCTAAGGTATATAAGCTGGTGGGAGAAAATGAAAACCTATATTTAAAAATGACGGACAGCCGGTATAAAGGGACCA CCTATGATGTGGAACGGGAAAAGGACATGATGCTATGGCTGGAAGGAAAGCTGCCTGTTCCAAAGGTCCTGCACTTTGAA CGGCATGATGGCTGGAGCAATCTGCTCATGAGTGAGGCCGATGGCGTCCTTTGCTCGGAAGAGTATGAAGATGAACAAAG CCCTGAAAAGATTATCGAGCTGTATGCGGAGTGCATCAGGCTCTTTCACTCCATCGACATATCGGATTGTCCCTATACGA ATAGCTTAGACAGCCGCTTAGCCGAATTGGATTACTTACTGAATAACGATCTGGCCGATGTGGATTGCGAAAACTGGGAA GAAGACACTCCATTTAAAGATCCGCGCGAGCTGTATGATTTTTTAAAGACGGAAAAGCCCGAAGAGGAACTTGTCTTTTC CCACGGCGACCTGGGAGACAGCAACATCTTTGTGAAAGATGGCAAAGTAAGTGGCTTTATTGATCTTGGGAGAAGCGGCA GGGCGGACAAGTGGTATGACATTGCCTTCTGCGTCCGGTCGATCAGGGAGGATATCGGGGAAGAACAGTATGTCGAGCTA TTTTTTGACTTACTGGGGATCAAGCCTGATTGGGAGAAAATAAAATATTATATTTTACTGGATGAATTGTTTTAG
KanR2 ATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAA ATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTC TGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCT CTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATT CCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGA TTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTG GTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCC ATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTT GTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCT CCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCT CGATGAGTTTTTCTAA
Neomycin ATGGGATCGGCCATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTG GGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGA CCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGC GCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTC ATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCT GCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGAT CTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGATGATCT CGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCC GGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCT GACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTT C
strep ATGGCAACAGTTAACCAGCTGGTACGCAAACCACGTGCTCGCAAAGTTGCGAAAAGCAACGTGCCTGCGCTGGAAGCATG CCCGCAAAAACGTGGCGTATGTACTCGTGTATATACTACCACTCCTAAAAAACCGAACTCCGCGCTGCGTAAAGTATGCC GTGTTCGTCTGACTAACGGTTTCGAAGTGACTTCCTACATCGGTGGTGAAGGTCACAACCTGCAGGAGCACTCCGTGATC CTGATCCGTGGCGGTCGTGTTAAAGACCTCCCGGGTGTTCGTTACCACACCGTACGTGGTGCGCTTGACTGCTCCGGCGT TAAAGACCGTAAGCAGGCTCGTTCCAAGTATGGCGTGAAGCGTCCTAAGGCTTAA
spect GTGAGGAGGATATATTTGAATACATACGAACAAATTAATAAAGTGAAAAAAATACTTCGGAAACATTTAAAAAATAACCT TATTGGTACTTACATGTTTGGATCAGGAGTTGAGAGTGGACTAAAACCAAATAGTGATCTTGACTTTTTAGTCGTCGTAT CTGAACCATTGACAGATCAAAGTAAAGAAATACTTATACAAAAAATTAGACCTATTTCAAAAAAAATAGGAGATAAAAGC AACTTACGATATATTGAATTAACAATTATTATTCAGCAAGAAATGGTACCGTGGAATCATCCTCCCAAACAAGAATTTAT TTATGGAGAATGGTTACAAGAGCTTTATGAACAAGGATACATTCCTCAGAAGGAATTAAATTCAGATTTAACCATAATGC TTTACCAAGCAAAACGAAAAAATAAAAGAATATACGGAAATTATGACTTAGAGGAATTACTACCTGATATTCCATTTTCT GATGTGAGAAGAGCCATTATGGATTCGTCAGAGGAATTAATAGATAATTATCAGGATGATGAAACCAACTCTATATTAAC TTTATGCCGTATGATTTTAACTATGGACACGGGTAAAATCATACCAAAAGATATTGCGGGAAATGCAGTGGCTGAATCTT CTCCATTAGAACATAGGGAGAGAATTTTGTTAGCAGTTCGTAGTTATCTTGGAGAGAATATTGAATGGACTAATGAAAAT GTAAATTTAACTATAAACTATTTAAATAACAGATTAAAAAAATTATAA
spect ATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTA TGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGT TATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCC GAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTA CGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAA CAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAA GTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCG CAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAAC ATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAAT GAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTG GTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATC AGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAA GAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAA
hygroB ATGGATAGATCCGGAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCGTCTCCGA CCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAA ATAGCTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTG CTTGACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGTCACGTTGCAAGACCTGCC TGAAACCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCCATGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGA GCGGGTTCGGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCC CATGTGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCGATGAGCTGATGCTTTG GGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATTTCGGCTCCAACAATGTCCTGACGGACAATGGCCGCA TAACAGCGGTCATTGACTGGAGCGAGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCG TGGTTGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGATCGCCGCGGCTCCGGGC GTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGGTTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGG GTCGATGCGACGCAATCGTCCGATCCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGG ACCGATGGCTGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGCAAAGGAA
blast_S ATGAAAACATTTAACATTTCTCAACAAGATCTAGAATTAGTAGAAGTAGCGACAGAGAAGATTACAATGCTTTATGAGGA TAATAAACATCATGTGGGAGCGGCAATTCGTACGAAAACAGGAGAAATCATTTCGGCAGTACATATTGAAGCGTATATAG GACGAGTAACTGTTTGTGCAGAAGCCATTGCGATTGGTAGTGCAGTTTCGAATGGACAAAAGGATTTTGACACGATTGTA GCTGTTAGACACCCTTATTCTGACGAAGTAGATAGAAGTATTCGAGTGGTAAGTCCTTGTGGTATGTGTAGGGAGTTGAT TTCAGACTATGCACCAGATTGTTTTGTGTTAATAGAAATGAATGGCAAGTTAGTCAAAACTACGATTGAAGAACTCATTC CACTCAAATATACCCGAAATTAA
blast ATGGCCAAGCCTTTGTCTCAAGAAGAATCCACCCTCATTGAAAGAGCAACGGCTACAATCAACAGCATCCCCATCTCTGA AGACTACAGCGTCGCCAGCGCAGCTCTCTCTAGCGACGGCCGCATCTTCACTGGTGTCAATGTATATCATTTTACTGGGG GACCTTGTGCAGAACTCGTGGTGCTGGGCACTGCTGCTGCTGCGGCAGCTGGCAACCTGACTTGTATCGTCGCGATCGGA AATGAGAACAGGGGCATCTTGAGCCCCTGCGGACGGTGTCGACAGGTGCTTCTCGATCTGCATCCTGGGATCAAAGCGAT AGTGAAGGACAGTGATGGACAGCCGACGGCAGTTGGGATTCGTGAATTGCTGCCCTCTGGTTATGTGTGGGAGGGCTAA
eryth ATGAACGAGAAAAATATAAAACACAGTCAAAACTTTATTACTTCAAAACATAATATAGATAAAATAATGACAAATATAAG ATTAAATGAACATGATAATATCTTTGAAATCGGCTCAGGAAAAGGCCATTTTACCCTTGAATTAGTAAAGAGGTGTAATT TCGTAACTGCCATTGAAATAGACCATAAATTATGCAAAACTACAGAAAATAAACTTGTTGATCACGATAATTTCCAAGTT TTAAACAAGGATATATTGCAGTTTAAATTTCCTAAAAACCAATCCTATAAAATATATGGTAATATACCTTATAACATAAG TACGGATATAATACGCAAAATTGTTTTTGATAGTATAGCTAATGAGATTTATTTAATCGTGGAATACGGGTTTGCTAAAA GATTATTAAATACAAAACGCTCATTGGCATTACTTTTAATGGCAGAAGTTGATATTTCTATATTAAGTATGGTTCCAAGA GAATATTTTCATCCTAAACCTAAAGTGAATAGCTCACTTATCAGATTAAGTAGAAAAAAATCAAGAATATCACACAAAGA TAAACAAAAGTATAATTATTTCGTTATGAAATGGGTTAACAAAGAATACAAGAAAATATTTACAAAAAATCAATTTAACA ATTCCTTAAAACATGCAGGAATTGACGATTTAAACAATATTAGCTTTGAACAATTCTTATCTCTTTTCAATAGCTATAAA TTATTTAATAAGTAA
CAT/CamR ATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTC AGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACA AGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTACGTATGGCAATGAAAGACGGT GAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAG TGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATT TCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTG GCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCT GGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATG AGTGGCAGGGCGGGGCGTAA
LEU2 ATGTCTGCCCCTATGTCTGCCCCTAAGAAGATCGTCGTTTTGCCAGGTGACCACGTTGGTCAAGAAATCACAGCCGAAGC CATTAAGGTTCTTAAAGCTATTTCTGATGTTCGTTCCAATGTCAAGTTCGATTTCGAAAATCATTTAATTGGTGGTGCTG CTATTGATGCTACAGGTGTCCCACTTCCAGATGAGGCGCTGGAAGCCTCCAAGAAGGCTGATGCCGTTTTGTTAGGTGCT GTGGGTGGTCCTAAATGGGGTACTGGTAGTGTTAGACCTGAACAAGGTTTACTAAAAATCCGTAAAGAACTTCAATTGTA CGCCAACTTAAGACCATGTAACTTTGCATCCGACTCTCTTTTAGACTTATCTCCAATCAAGCCACAATTTGCTAAAGGTA CTGACTTCGTTGTTGTCAGAGAATTAGTGGGAGGTATTTACTTTGGTAAGAGAAAGGAAGACGATGGTGATGGTGTCGCT TGGGATAGTGAACAATACACCGTTCCAGAAGTGCAAAGAATCACAAGAATGGCCGCTTTCATGGCCCTACAACATGAGCC ACCATTGCCTATTTGGTCCTTGGATAAAGCTAATGTTTTGGCCTCTTCAAGATTATGGAGAAAAACTGTGGAGGAAACCA TCAAGAACGAGTTCCCTACATTGAAGGTTCAACATCAATTGATTGATTCTGCCGCCATGATCCTAGTTAAGAACCCAACC CACCTAAATGGTATTATAATCACCAGCAACATGTTTGGTGATATTATCTCCGATGAAGCCTCCGTTATCCCAGGTTCCTT GGGTTTGTTGCCATCTGCGTCCTTGGCCTCTTTGCCAGACAAGAACACCGCATTTGGTTTGTACGAACCATGCCACGGTT CTGCTCCAGATTTGCCAAAGAATAAGGTCAACCCTATCGCCACTATCTTGTCTGCTGCAATGATGTTGAAATTGTCATTG AACTTGCCTGAAGAAGGTAAGGCCATTGAAGATGCAGTTAAAAAGGTTTTGGATGCAGGTATCAGAACTGGTGATTTAGG TGGTTCCAACAGTACCACCGAAGTCGGTGATGCTGTCGCCGAAGAAGTTAAGAAAATCCTTGCTTAA
TRP1 ATGTCTGTTATTAATTTCACAGGTAGTTCTGGTCCATTGGTGAAAGTTTGCGGCTTGCAGAGCACAGAGGCCGCAGAATG TGCTCTAGATTCCGATGCTGACTTGCTGGGTATTATATGTGTGCCCAATAGAAAGAGAACAATTGACCCGGTTATTGCAA GGAAAATTTCAAGTCTTGTAAAAGCATATAAAAATAGTTCAGGCACTCCGAAATACTTGGTTGGCGTGTTTCGTAATCAA CCTAAGGAGGATGTTTTGGCTCTGGTCAATGATTACGGCATTGATATCGTCCAACTGCATGGAGATGAGTCGTGGCAAGA ATACCAAGAGTTCCTCGGTTTGCCAGTTATTAAAAGACTCGTATTTCCAAAAGACTGCAACATACTACTCAGTGCAGCTT CACAGAAACCTCATTCGTTTATTCCCTTGTTTGATTCAGAAGCAGGTGGGACAGGTGAACTTTTGGATTGGAACTCGATT TCTGACTGGGTTGGAAGGCAAGAGAGCCCCGAAAGCTTACATTTTATGTTAGCTGGTGGACTGACGCCAGAAAATGTTGG TGATGCGCTTAGATTAAATGGCGTTATTGGTGTTGATGTAAGCGGAGGTGTGGAGACAAATGGTGTAAAAGACTCTAACA AAATAGCAAATTTCGTCAAAAATGCTAAGAAATAG
trpE ATGCAAACACAAAAACCGACTCTCGAACTGCTAACCTGCGAAGGCGCTTATCGCGACAATCCCACCGCGCTTTTTCACCA GTTGTGTGGGGATCGTCCGGCAACGCTGCTGCTGGAATCCGCAGATATCGACAGCAAAGATGATTTAAAAAGCCTGCTGC TGGTAGACAGTGCGCTGCGCATTACAGCTTTAGGTGACACTGTCACAATCCAGGCACTTTCCGGCAACGGCGAAGCCCTC CTGGCACTACTGGATAACGCCCTGCCTGCGGGTGTGGAAAGTGAACAATCACCAAACTGCCGTGTGCTGCGCTTCCCCCC TGTCAGTCCACTGCTGGATGAAGACGCCCGCTTATGCTCCCTTTCGGTTTTTGACGCTTTCCGTTTATTGCAGAATCTGT TGAATGTACCGAAGGAAGAACGAGAAGCCATGTTCTTCAGCGGCCTGTTCTCTTATGACCTTGTGGCGGGATTTGAAGAT TTACCGCAACTGTCAGCGGAAAATAACTGCCCTGATTTCTGTTTTTATCTCGCTGAAACGCTGATGGTGATTGACCATCA GAAAAAAAGCACCCGTATTCAGGCCAGCCTGTTTGCTCCGAATGAAGAAGAAAAACAACGTCTCACTGCTCGCCTGAACG AACTACGTCAGCAACTGACCGAAGCCGCGCCGCCGCTGCCAGTGGTTTCCGTGCCGCATATGCGTTGTGAATGTAATCAG AGCGATGAAGAGTTCGGTGGCGTAGTGCGTTTGTTGCAAAAAGCGATTCGCGCTGGAGAAATTTTCCAGGTGGTGCCATC TCGCCGTTTCTCTCTGCCCTGCCCGTCACCGCTGGCGGCCTATTACGTGCTGAAAAAGAGTAATCCCAGCCCGTACATGT TTTTTATGCAGGATAATGATTTCACCCTATTTGGCGCGTCGCCGGAAAGCTCGCTCAAGTATGATGCCACCAGCCGCCAG ATTGAGATCCCCCGGAATTCGAGCTCGCCCGGGGATCCTCTAGAGTCGACCTGCAGCCCAAGCTTATCGATGATAAGCTG TCAAACATGA
HIS3 ATGACAGAGCAGAAAGCCCTAGTAAAGCGTATTACAAATGAAACCAAGATTCAGATTGCGATCTCTTTAAAGGGTGGTCC CCTAGCGATAGAGCACTCGATCTTCCCAGAAAAAGAGGCAGAAGCAGTAGCAGAACAGGCCACACAATCGCAAGTGATTA ACGTCCACACAGGTATAGGGTTTCTGGACCATATGATACATGCTCTGGCCAAGCATTCCGGCTGGTCGCTAATCGTTGAG TGCATTGGTGACTTACACATAGACGACCATCACACCACTGAAGACTGCGGGATTGCTCTCGGTCAAGCTTTTAAAGAGGC CCTACTGGCGCGTGGAGTAAAAAGGTTTGGATCAGGATTTGCGCCTTTGGATGAGGCACTTTCCAGAGCGGTGGTAGATC TTTCGAACAGGCCGTACGCAGTTGTCGAACTTGGTTTGCAAAGGGAGAAAGTAGGAGATCTCTCTTGCGAGATGATCCCG CATTTTCTTGAAAGCTTTGCAGAGGCTAGCAGAATTACCCTCCACGTTGATTGTCTGCGAGGCAAGAATGATCATCACCG TAGTGAGAGTGCGTTCAAGGCTCTTGCGGTTGCCATAAGAGAAGCCACCTCGCCCAATGGTACCAACGATGTTCCCTCCA CCAAAGGTGTTCTTATG
URA3 ATGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCTATTTAATATCATGCACGA AAAGCAAACAAACTTGTGTGCTTCATTGGATGTTCGTACCACCAAGGAATTACTGGAGTTAGTTGAAGCATTAGGTCCCA AAATTTGTTTACTAAAAACACATGTGGATATCTTGACTGATTTTTCCATGGAGGGCACAGTTAAGCCGCTAAAGGCATTA TCCGCCAAGTACAATTTTTTACTCTTCGAAGACAGAAAATTTGCTGACATTGGTAATACAGTCAAATTGCAGTACTCTGC GGGTGTATACAGAATAGCAGAATGGGCAGACATTACGAATGCACACGGTGTGGTGGGCCCAGGTATTGTTAGCGGTTTGA AGCAGGCGGCAGAAGAAGTAACAAAGGAACCTAGAGGCCTTTTGATGTTAGCAGAATTGTCATGCAAGGGCTCCCTATCT ACTGGAGAATATACTAAGGGTACTGTTGACATTGCGAAGAGCGACAAAGATTTTGTTATCGGCTTTATTGCTCAAAGAGA CATGGGTGGAAGAGATGAAGGTTACGATTGGTTGATTATGACACCCGGTGTGGGTTTAGATGACAAGGGAGACGCATTGG GTCAACAGTATAGAACCGTGGATGATGTGGTCTCTACAGGATCTGACATTATTATTGTTGGAAGAGGACTATTTGCAAAG GGAAGGGATGCTAAGGTAGAGGGTGAACGTTACAGAAAAGCAGGCTGGGAAGCATATTTGAGAAGATGCGGCCAGCAAAA C
HIS4 ATGACATTTCCCTTGCTACCTGCATACGCAAGTGTTGCAGAGTTTGATAATTCCTTGAGTTTGGTAGGAAAAGCCGTGTT TCCCTATGCTGCTGACCAGCTGCACAACCTGATCAAGTTCACTCAATCGACTGAGCTTCAAGTTAATGTGCAAGTTGAGT CATCCGTTACAGAGGACCAATTTGAGGAGCTGATCGACAACTTGCTCAAGTTGTACAATAATGGTATCAATGAAGTGATT TTGGACCTAGATTTGGCAGAAAGAGTTGTCCAAAGGATCCCAGGCGCTAGGGTTATCTATAGGACCCTGGTTGATAAAGT TGCATCCTTGCCCGCTAATGCTAGTATCGCTGTGCCTTTTTCTTCTCCACTGGGCGATTTGAAAAGTTTCACTAATGGCG GTAGTAGAACTGTTTATGCTTTTTCTGAGACCGCAAAGTTGGTAGATGTGACTTCCACTGTTGCTTCTGGTATAATCCCC ATTATTGATGCTCGGCAATTGACTACTGAATACGAACTTTCTGAAGATGTCAAAAAGTTCCCTGTCAGTGAAATTTTGTT GGCGTCTTTGACTACTGACCGCCCCGATGGTCTATTCACTACTTTGGTGGCTGACTCTTCTAATTACTCGTTGGGCCTGG TGTACTCGTCCAAAAAGTCTATTCCGGAGGCTATAAGGACACAAACTGGAGTCTACCAATCTCGTCGTCACGGTTTGTGG TATAAAGGTGCTACATCTGGAGCAACTCAAAAGTTGCTGGGTATCGAATTGGATTGTGATGGAGACTGCTTGAAATTTGT GGTTGAACAAACAGGTGTTGGTTTCTGTCACTTGGAACGCACTTCCTGTTTTGGCCAATCAAAGGGTCTTAGAGCCATGG AAGCCACCTTGTGGGATCGTAAGAGCAATGCTCCAGAAGGTTCTTATACCAAACGGTTATTTGACGACGAAGTTTTGTTG AACGCTAAAATTAGGGAGGAAGCTGATGAACTTGCAGAAGCTAAATCCAAGGAAGATATAGCCTGGGAATGTGCTGACTT ATTTTATTTTGCATTAGTTAGATGTGCCAAGTACGGCGTGACGTTGGACGAGGTGGAGAGAAACCTGGATATGAAGTCCC TAAAGGTCACTAGAAGGAAAGGAGATGCCAAGCCAGGATACACCAAGGAACAACCTAAAGAAGAATCCAAACCTAAAGAA GTCCCTTCTGAAGGTCGTATTGAATTGTGCAAAATTGACGTTTCTAAGGCCTCCTCACAAGAAATTGAAGATGCCCTTCG TCGTCCTATCCAGAAAACGGAACAGATTATGGAATTAGTCAAACCAATTGTCGACAATGTTCGTCAAAATGGTGACAAAG CCCTTTTAGAACTAACTGCCAAGTTTGATGGAGTCGCTTTGAAGACACCTGTGTTAGAAGCTCCTTTCCCAGAGGAACTT ATGCAATTGCCAGATAACGTTAAGAGAGCCATTGATCTCTCTATAGATAACGTCAGGAAATTCCATGAAGCTCAACTAGC GGAGACGTTGCAAGTTGAGACTTGCCCTGGTGTAGTCTGCTCTCGTTTTGCAAGACCTATTGAGAAAGTTGGCCTCTATA TTCCTGGTGGAACCGCAATTCTGCCTTCCACTTCCCTGATGCTGGGTGTTCCTGCCAAAGTTGCTGGTTGCAAAGAAATT GTTTTTGCATCTCCACCTAAGAAGGATGGTACCCTTACCCCAGAAGTCATCTACGTTGCCCACAAGGTTGGTGCTAAGTG TATCGTGCTAGCAGGAGGCGCCCAGGCAGTAGCTGCTATGGCTTACGGAACAGAAACTGTTCCTAAGTGTGACAAAATAT TTGGTCCAGGAAACCAGTTCGTTACTGCTGCCAAGATGATGGTTCAAAATGACACATCAGCCCTGTGTAGTATTGACATG CCTGCTGGGCCTTCTGAAGTTCTAGTTATTGCTGATAAATACGCTGATCCAGATTTCGTTGTCTCAGACCTTCTGTCTCA AGCTGAACATGGTATTGATTCCCAGGTGATTCTGTTGGCTGTCGATATGACAGACAAGGAGCTTGCCAGAATTGAAGATG CTGTTCACAACCAAGCTGTGCAGTTGCCAAGGGTTGAAATTGTACGCAAGTGTATTGCACACTCTACAACCCTATCGGTT GCAACCTACGAGCAGGCTTTGGAAATGTCCAATCAGTACGCTCCTGAACACTTGATCCTGCAAATCGAGAATGCTTCTTA TGTTGATCAAGTACAACACGCTGGATCTGTGTTTGTTGGTGCCTACTCTCCAGAGAGTTGTGGAGATTACTCCTCCGGTA CCAACCACACTTTGCCAACGTACGGATATGCCCGTCAATACAGCGGAGTTAACACTGCAACCTTCCAGAAGTTCATCACT TCACAAGACGTAACTCCTGAGGGACTGAAACATATTGGCCAAGCAGTGATGGATCTGGCTGCTGTTGAAGGTCTAGATGC TCACCGCAATGCTGTTAAGGTTCGTATGGAGAAACTGGGACTTATTTAA
sacB ATGAACATCAAAAAAATTGTAAAACAAGCCACAGTTCTGACTTTTACGACTGCACTTCTGGCAGGAGGAGCGACTCAAGC CTTCGCGAAAGAAAATAACCAAAAAGCATACAAAGAAACGTACGGCGTCTCTCATATTACACGCCATGATATGCTGCAGA TCCCTAAACAGCAGCAAAACGAAAAATACCAAGTGCCTCAATTCGATCAATCAACGATTAAAAATATTGAGTCTGCAAAA GGACTTGATGTGTGGGACAGCTGGCCGCTGCAAAACGCTGACGGAACAGTAGCTGAATACAACGGCTATCACGTTGTGTT TGCTCTTGCGGGAAGCCCGAAAGACGCTGATGACACATCAATCTACATGTTTTATCAAAAGGTCGGCGACAACTCAATCG ACAGCTGGAAAAACGCGGGCCGTGTCTTTAAAGACAGCGATAAGTTCGACGCCAACGATCCGATCCTGAAAGATCAGACG CAAGAATGGTCCGGTTCTGCAACCTTTACATCTGACGGAAAAATCCGTTTATTCTACACTGACTATTCCGGTAAACATTA CGGCAAACAAAGCCTGACAACAGCGCAGGTAAATGTGTCAAAATCTGATGACACACTCAAAATCAACGGAGTGGAAGATC ACAAAACGATTTTTGACGGAGACGGAAAAACATATCAGAACGTTCAGCAGTTTATCGATGAAGGCAATTATACATCCGGC GACAACCATACGCTGAGAGACCCTCACTACGTTGAAGACAAAGGCCATAAATACCTTGTATTCGAAGCCAACACGGGAAC AGAAAACGGATACCAAGGCGAAGAATCTTTATTTAACAAAGCGTACTACGGCGGCGGCACGAACTTCTTCCGTAAAGAAA GCCAGAAGCTTCAGCAGAGCGCTAAAAAACGCGATGCTGAGTTAGCGAACGGCGCCCTCGGTATCATAGAGTTAAATAAT GATTACACATTGAAAAAAGTAATGAAGCCGCTGATCACTTCAAACACGGTAACTGATGAAATCGAGCGCGCGAATGTTTT CAAAATGAACGGCAAATGGTACTTGTTCACTGATTCACGCGGTTCAAAAATGACGATCGATGGTATTAACTCAAACGATA TTTACATGCTTGGTTATGTATCACACTCTTTAACCGGCCCTTACAAGCCGCTGAACAAAACAGGGCTTGTGCTGCAAATG GGTCTTGATCCAAACGATGTGACATTCACTTACTCTCACTTCGCAGTGCCGCAAGCCAAAGGCAACAATGTGGTTATCAC AAGCTACATGACAAACAGAGGCTTCTTCGAGGATAAAAAGGCAACATTTGCGCCAAGCTTCTTAATGAACATCAAAGGCA ATAAAACATCCGTTGTCAAAAACAGCATCCTGGAGCAAGGACAGCTGACAGTCAACTAA
sacB_neg GACGTCCACATATACCTGCCGTTCACTATTATTTAGTGAAATGAGATATTATGATATTTTCTGAATTGTGATTAAAAAGG CAACTTTATGCCCATGCAACAGAAACTATAAAAAATACAGAGAATGAAAAGAAACAGATAGATTTTTTAGTTCTTTAGGC CCGTAGTCTGCAAATCCTTTTATGATTTTCTATCAAACAAAAGAGGAAAATAGACCAGTTGCAATCCAAACGAGAGTCTA ATAGAATGAGGTCGAAAAGTAAATCGCGCGGGTTTGTTACTGATAAAGCAGGCAAGACCTAAAATGTGTAAAGGGCAAAG TGTATACTTTGGCGTCACCCCTTACATATTTTAGGTCTTTTTTTATTGTGCGTAACTAACTTGCCATCTTCAAACAGGAG GGCTGGAAGAAGCAGACCGCTAACACAGTACATAAAAAAGGAGACATGAACGATGAACATCAAAAAGTTTGCAAAACAAG CAACAGTATTAACCTTTACTACCGCACTGCTGGCAGGAGGCGCAACTCAAGCGTTTGCGAAAGAAACGAACCAAAAGCCA TATAAGGAAACATACGGCATTTCCCATATTACACGCCATGATATGCTGCAAATCCCTGAACAGCAAAAAAATGAAAAATA TCAAGTTCCTGAGTTCGATTCGTCCACAATTAAAAATATCTCTTCTGCAAAAGGCCTGGACGTTTGGGACAGCTGGCCAT TACAAAACGCTGACGGCACTGTCGCAAACTATCACGGCTACCACATCGTCTTTGCATTAGCCGGAGATCCTAAAAATGCG GATGACACATCGATTTACATGTTCTATCAAAAAGTCGGCGAAACTTCTATTGACAGCTGGAAAAACGCTGGCCGCGTCTT TAAAGACAGCGACAAATTCGATGCAAATGATTCTATCCTAAAAGACCAAACACAAGAATGGTCAGGTTCAGCCACATTTA CATCTGACGGAAAAATCCGTTTATTCTACACTGATTTCTCCGGTAAACATTACGGCAAACAAACACTGACAACTGCACAA GTTAACGTATCAGCATCAGACAGCTCTTTGAACATCAACGGTGTAGAGGATTATAAATCAATCTTTGACGGTGACGGAAA AACGTATCAAAATGTACAGCAGTTCATCGATGAAGGCAACTACAGCTCAGGCGACAACCATACGCTGAGAGATCCTCACT ACGTAGAAGATAAAGGCCACAAATACTTAGTATTTGAAGCAAACACTGGAACTGAAGATGGCTACCAAGGCGAAGAATCT TTATTTAACAAAGCATACTATGGCAAAAGCACATCATTCTTCCGTCAAGAAAGTCAAAAACTTCTGCAAAGCGATAAAAA ACGCACGGCTGAGTTAGCAAACGGCGCTCTCGGTATGATTGAGCTAAACGATGATTACACACTGAAAAAAGTGATGAAAC CGCTGATTGCATCTAACACAGTAACAGATGAAATTGAACGCGCGAACGTCTTTAAAATGAACGGCAAATGGTACCTGTTC ACTGACTCCCGCGGATCAAAAATGACGATTGACGGCATTACGTCTAACGATATTTACATGCTTGGTTATGTTTCTAATTC TTTAACTGGCCCATACAAGCCGCTGAACAAAACTGGCCTTGTGTTAAAAATGGATCTTGATCCTAACGATGTAACCTTTA CTTACTCACACTTCGCTGTACCTCAAGCGAAAGGAAACAATGTCGTGATTACAAGCTATATGACAAACAGAGGATTCTAC GCAGACAAACAATCAACGTTTGCGCCTAGCTTCCTGCTGAACATCAAAGGCAAGAAAACATCTGTTGTCAAAGACAGCAT CCTTGAACAAGGACAATTAACAGTTAACAAATAAAAACGCAAAAGAAAATGCCGATATCCTATTGGCATTG
pBR322_origin AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCG GTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATAC TGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCC TGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCG CAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACA GCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAG GAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAG CGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCG
R6Kg_origin CCATGTCAGCCGTTAAGTGTTCCTGTGTCACTCAAAATTGCTTTGAGAGGCTCTAAGGGCTTCTCAGTGCGTTACATCCC TGGCTTGTTGTCCACAACCGTTAAACCTTAAAAGCTTTAAAAGCCTTATATATTCTTTTTTTTCTTATAAAACTTAAAAC CTTAGAGGCTATTTAAGTTGCTGATTTATATTAATTTTATTGTTCAAACATGAGAGCTTAGTACGTGAAACATGAGAGCT TAGTACGTTAGCCATGAGAGCTTAGTACGTTAGCCATGAGGGTTTAGTTCGTTAAACATGAGAGCTTAGTACGTTAAACA TGAGAGCTTAGTACGTGAAACATGAGAGCTTAGTACGTACTATCAACAGGTTGAACTGCTGATCAACAGATC
p15A_origin GCGCTAGCGGAGTGTATACTGGCTTACTATGTTGGCACTGATGAGGGTGTCAGTGAAGTGCTTCATGTGGCAGGAGAAAA AAGGCTGCACCGGTGCGTCAGCAGAATATGTGATACAGGATATATTCCGCTTCCTCGCTCACTGACTCGCTACGCTCGGT CGTTCGACTGCGGCGAGCGGAAATGGCTTACGAACGGGGCGGAGATTTCCTGGAAGATGCCAGGAAGATACTTAACAGGG AAGTGAGAGGGCCGCGGCAAAGCCGTTTTTCCATAGGCTCCGCCCCCCTGACAAGCATCACGAAATCTGACGCTCAAATC AGTGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGCGGCTCCCTCGTGCGCTCTCCTGTTCCT GCCTTTCGGTTTACCGGTGTCATTCCGCTGTTATGGCCGCGTTTGTCTCATTCCACGCCTGACACTCAGTTCCGGGTAGG CAGTTCGCTCCAAGCTGGACTGTATGCACGAACCCCCCGTTCAGTCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTT GAGTCCAACCCGGAAAGACATGCAAAAGCACCACTGGCAGCAGCCACTGGTAATTGATTTAGAGGAGTTAGTCTTGAAGT CATGCGCCGGTTAAGGCTAAACTGAAAGGACAAGTTTTGGTGACTGCGCTCCTCCAAGCCAGTTACCTCGGTTCAAAGAG TTGGTAGCTCAGAGAACCTTCGAAAAACCGCCCTGCAAGGCGGTTTTTTCGTTTTCAGAGCAAGAGATTACGCGCAGACC AAAACGATCTCAAGAAGATCATCTTATTAATCAGATAAAATATTTCTAGATTTCAGTGCAATTTATCTCTTCAAATGTAG CACCTGAAGTCAGCCCCATACGATATAAGTTGT
SV40_origin ATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCC
pNO3097_origin CTGTCTGTCCACAGGACAGGCAGTGAATAGGTTTTCTTTTTAAATGAATGTAATTAAGTAGTTTAAAGGAGATATAAACA GGTGTTTAAAAGATACATTGCACCCTGTAAGACTGGCGGCTGGCGCTTTATGACATGAACGGTTGTAACCTTATGGGGAA GTCCCTTGCAGTTAAATGTGGATAAGCA
ss_origin TTTATGCCGAGAAAACTCTTGCTAGGAAGCTATGCGAAATAGACTAGTAGGGGTCGAGTCGACAGGCTGAAAGCTTGCCG ACCGAACACGACAGTCAGATTTCAGCATAGGTTTCTTCCTAGCAAGAGGAAATTGGAATAAA
ds_origin GGGGGCGTACTACGACCCCCC
f1_origin GCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGC TTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGAT TTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACG GTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAA
2micron_origin TTATCGATGATAAGCTGTCAAAGATGAGAATTAATTCCACGGACTATAGACTATACTAGATACTCCGTCTACTGTACGAT ACACTTCCGCTCAGGTCCTTGTCCTTTAACGAGGCCTTACCACTCTTTTGTTACTCTATTGATCCAGCTCAGCAAAGGCA GTGTGATCTAAGATTCTATCTTCGCGATGTAGTAAAACTAGCTAGACCGAGAAAGAGACTAGAAATGCAAAAGGCACTTC TACAATGGCTGCCATCATTATTATCCGATGTGACGCTGCAGCTTCTCAATGATATTCGAATACGCTTTGAGGAGATACAG CCTAATATCCGACAAACTGTTTTACAGATTTACGATCGTACTTGTTACCCATCATTGAATTTTGAACATCCGAACCTGGG AGTTTTCCCTGAAACAGATAGTATATTTGAACCTGTATAATAATATATAGTCTAGCGCTTTACGGAAGACAATGTATGTA TTTCGGTTCCTGGAGAAACTATTGCATCTATTGCATAGGTAATCTTGCACGTCGCATCCCCGGTTCATTTTCTGCGTTTC CATCTTGCACTTCAATAGCATATCTTTGTTAACGAAGCATCTGTGCTTCATTTTGTAGAACAAAAATGCAACGCGAGAGC GCTAATTTTTCAAACAAAGAATCTGAGCTGCATTTTTACAGAACAGAAATGCAACGCGAAAGCGCTATTTTACCAACGAA GAATCTGTGCTTCATTTTTGTAAAACAAAAATGCAACGCGACGAGAGCGCTAATTTTTCAAACAAAGAATCTGAGCTGCA TTTTTACAGAACAGAAATGCAACGCGAGAGCGCTATTTTACCAACAAAGAATCTATACTTCTTTTTTGTTCTACAAAAAT GCATCCCGAGAGCGCTATTTTTCTAACAAAGCATCTTAGATTACTTTTTTTCTCCTTTGTGCGCTCTATAATGCAGTCTC TTGATAACTTTTTGCACTGTAGGTCCGTTAAGGTTAGAAGAAGGCTACTTTGGTGTCTATTTTCTCTTCCATAAAAAAAG CCTGACTCCACTTCCCGCGTTTACTGATTACTAGCGAAGCTGCGGGTGCATTTTTTCAAGATAAAGGCATCCCCGATTAT ATTCTATACCGATGTGGATTGCGCATACTTTGTGAACAGAAAGTGATAGCGTTGATGATTCTTCATTGGTCAGAAAATTA TGAACGGTTTCTTCTATTTTGTCTCTATATACTACGTATAGGAAATGTTTACATTTTCGTATTGTTTTCGATTCACTCTA TGAATAGTTCTTACTACAATTTTTTTGTCTAAAGAGTAATACTAGAGATAAACATAAAAAATGTAGAGGTCGAGTTTAGA TGCAAGTTCAAGGAGCGAAAGGTGGATGGGTAGGTTATATAGGGATATAGCACAGAGATATATAGCAAAGAGATACTTTT GAGCAATGTTTGTGGAAGCGGTATTCGCAATG
2micron2_origin ACGCATTTAAGCATAAACACGCACTATGCCGTTCTTCTCATGTATATATATATACAGGCAACACGCAGATATAGGTGCGA CGTGAACAGTGAGCTGTATGTGCGCAGCTCGCGTTGCATTTTCGGAAGCGCTCGTTTTCGGAAACGCTTTGAAGTTCCTA TTCCGAAGTTCCTATTCTCTAGCTAGAAAGTATAGGAACTTCAGAGCGCTTTTGAAAACCAAAAGCGCTCTGAAGACGCA CTTTCAAAAAACCAAAAACGCACCGGACTGTAACGAGCTACTAAAATATTGCGAATACCGCTTCCACAAACATTGCTCAA AAGTATCTCTTTGCTATATATCTCTGTGCTATATCCCTATATAACCTACCCATCCACCTTTCGCTCCTTGAACTTGCATC TAAACTCGACCTCTACATTTTTTATGTTTATCTCTAGTATTACTCTTTAGACAAAAAAATTGTAGTAAGAACTATTCATA GAGTGAATCGAAAACAATACGAAAATGTAAACATTTCCTATACGTAGTATATAGAGACAAAATAGAAGAAACCGTTCATA ATTTTCTGACCAATGAAGAATCATCAACGCTATCACTTTCTGTTCACAAAGTATGCGCAATCCACATCGGTATAGAATAT AATCGGGGATGCCTTTATCTTGAAAAAATGCACCCGCAGCTTCGCTAGTAATCAGTAAACGCGGGAAGTGGAGTCAGGCT TTTTTTATGGAAGAGAAAATAGACACCAAAGTAGCCTTCTTCTAACCTTAACGGACCTACAGTGCAAAAAGTTATCAAGA GACTGCATTATAGAGCGCACAAAGGAGAAAAAAAGTAATCTAAGATGCTTTGTTAGAAAAATAGCGCTCTCGGGATGCAT TTTTGTAGAACAAAAAAGAAGTATAGATTCTTTGTTGGTAAAATAGCGCTCTCGCGTTGCATTTCTGTTCTGTAAAAATG CAGCTCAGATTCTTTGTTTGAAAAATTAGCGCTCTCGCGTTGCATTTTTGTTTTACAAAAATGAAGCACAGATTCTTCGT TGGTAAAATAGCGCTTTCGCGTTGCATTTCTGTTCTGTAAAAATGCAGCTCAGATTCTTTGTTTGAAAAATTAGCGCTCT CGCGTTGCATTTTTGTTCTACAAAATGAAGCACAGATGCTTCGTT
EBV_origin CATTAAACGGCATGCAGGAAAAGGACAAGCAGCGAAAATTCACGCCCCCTTGGGAGGTGGCGGCATATGCAAAGGATAGC ACTCCCACTCTACTACTGGGTATCATATGCTGACTGTATATGCATGAGGATAGCATATGCTACCCGGATACAGATTAGGA TAGCATATACTACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGATAGCCTATGCTACCCAGATA TAAATTAGGATAGCATATACTACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGATAGCCTATGC TACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGATAGCATATGCTATCCAGATATTTGGGTAGT ATATGCTACCCAGATATAAATTAGGATAGCATATACTACCCTAATCTCTATTAGGATAGCATATGCTACCCGGATACAGA TTAGGATAGCATATACTACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGATAGCCTATGCTACC CAGATATAAATTAGGATAGCATATACTACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGATAGC CTATGCTACCCAGATATAGATTAGGATAGCATATGCTATCCAGATATTTGGGTAGTATATGCTACCCATGGCAACATTAG CCCACCGTGCTCTCAGCGACCTCGTGAATATGAGGACCAACAACCCTGTGCTTGGCGCTCAGGCGCAAGTGTGTGTAATT TGTCCTCCAGATCGCAGCAATCGCGCCCCTATCTTGGCCCGCCCACCTACTTATGCAGGTATTCCCCGGGGTGCCATTAG TGGTTTTGTGGGCAAGTGGTTTGACCGCAGTGGTTAGCGGGGTTACAATCAGCCAAGTTATTACACCCTTATTTTACAGT CCAAAACCGCAGGGCGGCGTGTGGGGGCTGACGCGTGCCCCCACTCCACAATTTCAAAAAAAAGAGTGGCCACTTGTCTT TGTTTATGGGCCCCATTGGCGTGGAGCCCCGTTTAATTTTCGGGGGTGTTAGAGACAACCAGTGGAGTCCGCTGCTGTCG GCGTCCACTCTCTTTCCCCTTGTTACAAATAGAGTGTAACAACATGGTTCACCTGTCTTGGTCCCTGCCTGGGACACATC TTAATAACCCCAGTATCATATTGCACTAGGATTATGTGTTGCCCATAGCCATAAATTCGTGTGAGATGGACATCCAGTCT TTACGGCTTGTCCCCACCCCATGGATTTCTATTGTTAAAGATATTCAGAATGTTTCATTCCTACACTAGTATTTATTGCC CAAGGGGTTTGTGAGGGTTATATTGGTGTCATAGCACAATGCCACCACTGAACCCCCCGTCCAAATTTTATTCTGGGGGC GTCACCTGAAACCTTGTTTTCGAGCACCTCACATACACCTTACTGTTCACAACTCAGCAGTTATTCTATTAGCTAAACGA AGGAGAATGAAGAAGCAGGCGAAGATTCAGGAGAGTTCACTGCCCGCTCCTTGATCTTCAGCCACTGCCCTTGTGACTAA AATGGTTCACTACCCTCGTGGAATCCTGACCCCATGTAAATAAAACCGTGACAGCTCATGGGGTGGGAGATATCGCTGTT CCTTAGGACCCTTTTACTAACCCTAATTCGATAGCATATGCTTCCCGTTGGGTAACATATGCTATTGAATTAGGGTTAGT CTGGATAGTATATACTACTACCCGGGAAGCATATGCTACCCGTTTAGGGTTAACAAGGGGGCCTTATAAACACTATTGCT AATGCCCTCTTGAGGGTCCGCTTATCGGTAGCTACACAGGCCCCTCTGATTGACGTTGGTGTAGCCTCCCGTAGTCTTCC TGGGCCCCTGGGAGGTACATGTCCCCCAGCATTGGTGTAAGAGCTTCAGCCAAGAGTTACACATAAAGGCAATGTTGTGT TGCAGTCCACAGACTGCAAAGTCTGCTCCAGGATGAAAGCCACTCAGTGTTGGCAAATGTGCACATCCATTTATAAGGAT GTCAACTACAGTCAGAGAACCCCTTTGTGTTTGGTCCCCCCCCGTGTCACATGTGGAACAGGGCCCAGTTGGCAAGTTGT ACCAACCAACTGAAGGGATTACA
GFP_ORF ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAA ATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAAC TACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAA CGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTA CAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAG ATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAAT GGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATAC TCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACG AAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAA
GFP ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATT CTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAGCTAC CTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCAAGATACCCAGATCATATGAAACAG CATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTACAAAGATGACGGGAACTACAA ATCACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTCGTTAATAGAATTGAGTTAAAAGGTATTGATTTTAAAGAAGATG GAAACATTCTTGGACACAAAATGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGA ATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCC AATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCCAAAGATCCCAACGAAA AGAGAGATCACATGATCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAA
GFP_cyc3 ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATT TTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTAC CTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGG CATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAA GACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATG GAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGA ATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCC AATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAA AGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAA
ECFP_cMyc_rhoB ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAA GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGC TGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTGGGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAG CAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTA CAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG ACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACATCAGCCACAACGTCTATATCACCGCCGACAAGCAGAAGAAC GGCATCAAGGCCAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACG AGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAC TCAGATCTCGAGCTCAAGCTTGATATCGAATTCCCCATGGAGCAGAAGCTGATCTCCGAGGAGGACCTGAACCGGAAGAA ACTGGTGGTTGTTGGTGATGGAGCCTGTGGAAAGACATGCTTGCTCATAGTCTTCAGCAAGGACGAGTTCCCAGAGGTGT ATGTGCCCACAGTGTTTGAGAACTATGTGGCAGATATCGAGGTGGATGGAAAGCAGGTAGAGTTGGCTTTGTGGGACACA GCTGGCCAGGAGGACTACGACCGCCTGCGGCCGCTCTCCTACCCGGACACCGACGTCATTCTCATGTGCTTCTCGGTGGA CAGCCCGGACTCGCTGGAGAACATCCCCGAGAAGTGGGTCCCCGAGGTGAAGCACTTCTGTCCCAATGTGCCCATCATCC TGGTGGCCAACAAAAAAGACCTGCGCAGCGACGAGCATGTCCGCACAGAGCTGGCCCGCATGAAGCAGGAACCCGTTCGC ACGGATGACGGCCGCGCCATGGCCGTGCGCATCCAAGCCTACGACTACCTCGAGTGCTCTGCCAAGACCAAGGAAGGCGT GCGCGAGGTCTTCGAGACGGCCACGCGCGCCGCGCTGCAGAAGCGCTACGGCTCCCAGAACGGCTGCATCAACTGCTGCA AGGTGCTATGA
EGFP ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAA GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGC TGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAG CAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTA CAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG ACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAAC GGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACG AGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG
ECFP ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAA GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGC TGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTGGGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAG CAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTA CAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG ACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACATCAGCCACAACGTCTATATCACCGCCGACAAGCAGAAGAAC GGCATCAAGGCCAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACG AGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG
d2EGFP ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAA GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGC TGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAG CAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTA CAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG ACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAAC GGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACG AGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGAAG CTTAGCCATGGCTTCCCGCCGGAGGTGGAGGAGCAGGATGATGGCACGCTGCCCATGTCTTGTGCCCAGGAGAGCGGGAT GGACCGTCACCCTGCAGCCTGTGCTTCTGCTAGGATCAATGTGTAG
ZsGreen ATGGCCCAGTCCAAGCACGGCCTGACCAAGGAGATGACCATGAAGTACCGCATGGAGGGCTGCGTGGATGGCCACAAGTT CGTGATCACCGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGGTGGAGGGCGGCCCCT TGCCCTTCGCCGAGGACATCTTGTCCGCCGCCTTCAACTACGGCAACCGCGTGTTCACCGAGTACCCCCAGGACATCGTC GACTACTTCAAGAACTCCTGCCCCGCCGGCTACACCTGGGACCGCTCCTTCCTGTTCGAGGACGGCGCCGTGTGCATCTG CAACGCCGACATCACCGTGAGCGTGGAGGAGAACTGCATGTACCACGAGTCCAAGTTCTACGGCGTGAACTTCCCCGCCG ACGGCCCCGTGATGAAGAAGATGACCGACAACTGGGAGCCCTCCTGCGAGAAGATCATCCCCGTGCCCAAGCAGGGCATC TTGAAGGGCGACGTGAGCATGTACCTGCTGCTGAAGGACGGTGGCCGCTTGCGCTGCCAGTTCGACACCGTGTACAAGGC CAAGTCCGTGCCCCGCAAGATGCCCGACTGGCACTTCATCCAGCACAAGCTGACCCGCGAGGACCGCAGCGACGCCAAGA ACCAGAAGTGGCACCTGACCGAGCACGCCATCGCCTCCGGCTCCGCCTTGCCC
EGFP-F ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAA GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGC TGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAG CAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTA CAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG ACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAAC GGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACG AGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTCC GGACTCAGATCTAAGCTGAACCCTCCTGATGAGAGTGGCCCCGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTGAGGA
ZsYellow CGCCACCATGGCTCATTCAAAGCACGGTCTAAAAGAAGAAATGACAATGAAATACCACATGGAAGGGTGCGTCAACGGAC ATAAATTTGTGATCACGGGCGAAGGCATTGGATATCCGTTCAAAGGGAAACAGACTATTAATCTGTGTGTGATCGAAGGG GGACCATTGCCATTTTCCGAAGACATATTGTCAGCTGGCTTTAAGTACGGAGACAGGATTTTCACTGAATATCCTCAAGA CATAGTAGACTATTTCAAGAACTCGTGTCCTGCTGGATATACATGGGGCAGGTCTTTTCTCTTTGAGGATGGAGCAGTCT GCATATGCAATGTAGATATAACAGTGAGTGTCAAAGAAAACTGCATTTATCATAAGAGCATATTTAATGGAGTGAATTTT CCTGCTGATGGACCTGTGATGAAAAAGATGACAACTAACTGGGAAGCATCCTGCGAGAAGATCATGCCAGTACCTAAGCA GGGGATACTGAAAGGGGATGTCTCCATGTACCTCCTTCTGAAGGATGGTGGGCGTTACCGGTGCCAGTTCGACACAGTTT ACAAAGCAAAGTCTGTGCCAAGTAAGATGCCGGAGTGGCACTTCATCCAGCATAAGCTCCTCCGTGAAGACCGCAGCGAT GCTAAGAATCAGAAGTGGCAGCTGACAGAGCATGCTATTGCATTCCCTTCTGCCTTGGCCTGA
d2EYFP ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAA GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGC TGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCGGCTACGGCCTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAG CAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTA CAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG ACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAAC GGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCTACCAGTCCGCCCTGAGCAAAGACCCCAACG AGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGAAG
EYFP GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTT CAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGC CCGTGCCCTGGCCCACCCTCGTGACCACCTTCGGCTACGGCCTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAG CACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAA GACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACG GCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGC ATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCC CATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCTACCAGTCCGCCCTGAGCAAAGACCCCAACGAGA AGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTCCGGA CTCAGATCTCGAGCT
DsRed2 ATGGCCTCCTCCGAGAACGTCATCACCGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCACCGTGAACGGCCACGAGTT CGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGACCAAGGGCGGCCCCC TGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCC GACTACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGCGACCGT GACCCAGGACTCCTCCCTGCAGGACGGCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCC CCGTGATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAG ACCCACAAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCTATCTACATGGCCAAGAAGCCCGT GCAGCTGCCCGGCTACTACTACGTGGACGCCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGT ACGAGCGCACCGAGGGCCGCCACCACCTGTTCCTGTAG
HcRed1 CGCCACCATGGTGAGCGGCCTGCTGAAGGAGAGTATGCGCATCAAGATGTACATGGAGGGCACCGTGAACGGCCACTACT TCAAGTGCGAGGGCGAGGGCGACGGCAACCCCTTCGCCGGCACCCAGAGCATGAGAATCCACGTGACCGAGGGCGCCCCC CTGCCCTTCGCCTTCGACATCCTGGCCCCCTGCTGCGAGTACGGCAGCAGGACCTTCGTGCACCACACCGCCGAGATCCC CGACTTCTTCAAGCAGAGCTTCCCCGAGGGCTTCACCTGGGAGAGAACCACCACCTACGAGGACGGCGGCATCCTGACCG CCCACCAGGACACCAGCCTGGAGGGCAACTGCCTGATCTACAAGGTGAAGGTGCACGGCACCAACTTCCCCGCCGACGGC CCCGTGATGAAGAACAAGAGCGGCGGCTGGGAGCCCAGCACCGAGGTGGTGTACCCCGAGAACGGCGTGCTGTGCGGCCG GAACGTGATGGCCCTGAAGGTGGGCGACCGGCACCTGATCTGCCACCACTACACCAGCTACCGGAGCAAGAAGGCCGTGC GCGCCCTGACCATGCCCGGCTTCCACTTCACCGACATCCGGCTCCAGATGCTGCGGAAGAAGAAGGACGAGTACTTCGAG CTGTACGAGGCCAGCGTGGCCCGGTACAGCGACCTGCCCGAGAAGGCCAACTGA
HcRed1-DR CGCCACCATGGTGAGCGGCCTGCTGAAGGAGAGTATGCGCATCAAGATGTACATGGAGGGCACCGTGAACGGCCACTACT TCAAGTGCGAGGGCGAGGGCGACGGCAACCCCTTCGCCGGCACCCAGAGCATGAGAATCCACGTGACCGAGGGCGCCCCC CTGCCCTTCGCCTTCGACATCCTGGCCCCCTGCTGCGAGTACGGCAGCAGGACCTTCGTGCACCACACCGCCGAGATCCC CGACTTCTTCAAGCAGAGCTTCCCCGAGGGCTTCACCTGGGAGAGAACCACCACCTACGAGGACGGCGGCATCCTGACCG CCCACCAGGACACCAGCCTGGAGGGCAACTGCCTGATCTACAAGGTGAAGGTGCACGGCACCAACTTCCCCGCCGACGGC CCCGTGATGAAGAACAAGAGCGGCGGCTGGGAGCCCAGCACCGAGGTGGTGTACCCCGAGAACGGCGTGCTGTGCGGCCG GAACGTGATGGCCCTGAAGGTGGGCGACCGGCACCTGATCTGCCACCACTACACCAGCTACCGGAGCAAGAAGGCCGTGC GCGCCCTGACCATGCCCGGCTTCCACTTCACCGACATCCGGCTCCAGATGCTGCGGAAGAAGAAGGACGAGTACTTCGAG CTGTACGAGGCCAGCGTGGCCCGGTACAGCGACCTGCCCGAGAAGGCCAACACTAGTGATATCAGCCATGGCTTCCCGCC GGCGGTGGCGGCGCAGGATGATGGCACGCTGCCCATGTCTTGTGCCCAGGAGAGCGGGATGGACCGTCACCCTGCAGCCT GTGCTTCTGCTAGGATCAATGTGTAG
AmCyan ATGGCTCTTTCAAACAAGTTTATCGGAGATGACATGAAAATGACCTACCATATGGATGGCTGTGTCAATGGGCATTACTT TACCGTCAAAGGTGAAGGCAGCGGGAAGCCATACGAAGGGACGCAGACCTCGACTTTTAAAGTCACCATGGCCAACGGTG GGCCCCTTGCATTCTCCTTTGACATACTATCTACAGTGTTCATGTATGGAAATCGATGCTTTACTGCGTATCCTACCAGT ATGCCCGACTATTTCAAACAAGCATTTCCTGACGGAATGTCATATGAAAGGACTTTTACCTATGAAGATGGAGGAGTTGC TACAGCCAGTTGGGAAATAAGCCTTAAAGGCAACTGCTTTGAGCACAAATCCACGTTTCATGGAGTGAACTTTCCTGCTG ATGGACCTGTGATGGCGAAGATGACAACTGGTTGGGACCCATCTTTTGAGAAAATGACTGTCTGCGATGGAATATTGAAG GGTGATGTCACCGCGTTCCTCATGCTGCAAGGAGGTGGCAATTACAGATGCCAATTCCACACTTCTTACAAGACAAAAAA ACCGGTGACGATGCCACCAAACCATGCGGTGGAACATCGCATTGCGAGGACCGACCTTGACAAAGGTGGCAACAGTGTTC AGCTGACGGAGCACGCTGTTGCACATATAACCTCTGTTGTCCCTTTCTGA
AsRed2 CGCCACCATGGCCTCTTTGCTGAAGAAGACCATGCCCTTCAGGACCACCATCGAGGGCACCGTGAACGGCCACTACTTCA AGTGCACCGGCAAGGGCGAGGGCAACCCCCTGGAGGGCACCCAGGAGATGAAGATCGAGGTGATCGAGGGCGGCCCCCTG CCCTTCGCCTTCCACATCCTGTCCACCTCCTGCATGTACGGCTCCAAGGCCTTCATCAAGTACGTGTCCGGCATCCCCGA CTACTTCAAGCAGTCCCTCCCCGAGGGCTTCACCTGGGAGCGCACCACCACCTACGAGGACGGCGGCTTCCTGACCGCCC ACCAGGACACCTCCCTGGACGGCGACTGCCTGGTGTACAAGGTGAAGATCCTGGGCAACAACTTCCCCGCCGACGGCCCC GTGATGCAGAACAAGGCCGGCCGCTGGGAGCCCTCCACCGAGATCGTGTACGAGGTGGACGGCGTGCTGCGCGGCCAGTC CCTGATGGCCCTGGAGTGCCCCGGCGGTCGCCACCTGACCTGCCACCTGCACACCACCTACCGCTCCAAGAAGCCCGCCT CCGCCCTGAAGATGCCCGGCTTCCACTTCGAGGACCACCGCATCGAGATCCTGGAGGAGGTGGAGAAGGGCAAGTGCTAC AAGCAGTACGAGGCCGCCGTGGGCCGCTACTGCGACGCCGCCCCCTCCAAGCTGGGCCACAACTGA
lacZ ATGTCGTTTACTTTGACCAACAAGAACGTGATTTTCGTTGCCGGTCTGGGAGGCATTGGTCTGGACACCAGCAAGGAGCT GCTCAAGCGCGATCCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCAC ATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGC GAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATAC TGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACGTAACCTATCCCATTACGGTCA ATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAA GGCCAGACGCGAATTATTTTTGATGGCGTTAACTCGGCGTTTCATCTGTGGTGCAACGGGCGCTGGGTCGGTTACGGCCA GGACAGTCGTTTGCCGTCTGAATTTGACCTGAGCGCATTTTTACGCGCCGGAGAAAACCGCCTCGCGGTGATGGTGCTGC GTTGGAGTGACGGCAGTTATCTGGAAGATCAGGATATGTGGCGGATGAGCGGCATTTTCCGTGACGTCTCGTTGCTGCAT AAACCGACTACACAAATCAGCGATTTCCATGTTGCCACTCGCTTTAATGATGATTTCAGCCGCGCTGTACTGGAGGCTGA AGTTCAGATGTGCGGCGAGTTGCGTGACTACCTACGGGTAACAGTTTCTTTATGGCAGGGTGAAACGCAGGTCGCCAGCG GCACCGCGCCTTTCGGCGGTGAAATTATCGATGAGCGTGGTGGTTATGCCGATCGCGTCACACTACGTCTGAACGTCGAA AACCCGAAACTGTGGAGCGCCGAAATCCCGAATCTCTATCGTGCGGTGGTTGAACTGCACACCGCCGACGGCACGCTGAT TGAAGCAGAAGCCTGCGATGTCGGTTTCCGCGAGGTGCGGATTGAAAATGGTCTGCTGCTGCTGAACGGCAAGCCGTTGC TGATTCGAGGCGTTAACCGTCACGAGCATCATCCTCTGCATGGTCAGGTCATGGATGAGCAGACGATGGTGCAGGATATC CTGCTGATGAAGCAGAACAACTTTAACGCCGTGCGCTGTTCGCATTATCCGAACCATCCGCTGTGGTACACGCTGTGCGA CCGCTACGGCCTGTATGTGGTGGATGAAGCCAATATTGAAACCCACGGCATGGTGCCAATGAATCGTCTGACCGATGATC CGCGCTGGCTACCGGCGATGAGCGAACGCGTAACGCGAATGGTGCAGCGCGATCGTAATCACCCGAGTGTGATCATCTGG TCGCTGGGGAATGAATCAGGCCACGGCGCTAATCACGACGCGCTGTATCGCTGGATCAAATCTGTCGATCCTTCCCGCCC GGTGCAGTATGAAGGCGGCGGAGCCGACACCACGGCCACCGATATTATTTGCCCGATGTACGCGCGCGTGGATGAAGACC AGCCCTTCCCGGCTGTGCCGAAATGGTCCATCAAAAAATGGCTTTCGCTACCTGGAGAGACGCGCCCGCTGATCCTTTGC GAATACGCCCACGCGATGGGTAACAGTCTTGGCGGTTTCGCTAAATACTGGCAGGCGTTTCGTCAGTATCCCCGTTTACA GGGCGGCTTCGTCTGGGACTGGGTGGATCAGTCGCTGATTAAATATGATGAAAACGGCAACCCGTGGTCGGCTTACGGCG GTGATTTTGGCGATACGCCGAACGATCGCCAGTTCTGTATGAACGGTCTGGTCTTTGCCGACCGCACGCCGCATCCAGCG CTGACGGAAGCAAAACACCAGCAGCAGTTTTTCCAGTTCCGTTTATCCGGGCAAACCATCGAAGTGACCAGCGAATACCT GTTCCGTCATAGCGATAACGAGCTCCTGCACTGGATGGTGGCGCTGGATGGTAAGCCGCTGGCAAGCGGTGAAGTGCCTC TGGATGTCGCTCCACAAGGTAAACAGTTGATTGAACTGCCTGAACTACCGCAGCCGGAGAGCGCCGGGCAACTCTGGCTC ACAGTACGCGTAGTGCAACCGAACGCGACCGCATGGTCAGAAGCCGGGCACATCAGCGCCTGGCAGCAGTGGCGTCTGGC GGAAAACCTCAGTGTGACGCTCCCCGCCGCGTCCCACGCCATCCCGCATCTGACCACCAGCGAAATGGATTTTTGCATCG AGCTGGGTAATAAGCGTTGGCAATTTAACCGCCAGTCAGGCTTTCTTTCACAGATGTGGATTGGCGATAAAAAACAACTG CTGACGCCGCTGCGCGATCAGTTCACCCGTGCACCGCTGGATAACGACATTGGCGTAAGTGAAGCGACCCGCATTGACCC TAACGCCTGGGTCGAACGCTGGAAGGCGGCGGGCCATTACCAGGCCGAAGCAGCGTTGTTGCAGTGCACGGCAGATACAC TTGCTGATGCGGTGCTGATTACGACCGCTCACGCGTGGCAGCATCAGGGGAAAACCTTATTTATCAGCCGGAAAACCTAC CGGATTGATGGTAGTGGTCAAATGGCGATTACCGTTGATGTTGAAGTGGCGAGCGATACACCGCATCCGGCGCGGATTGG CCTGAACTGCCAGCTGGCGCAGGTAGCAGAGCGGGTAAACTGGCTCGGATTAGGGCCGCAAGAAAACTATCCCGACCGCC TTACTGCCGCCTGTTTTGACCGCTGGGATCTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGGT CTGCGCTGCGGGACGCGCGAATTGAATTATGGCCCACACCAGTGGCGCGGCGACTTCCAGTTCAACATCAGCCGCTACAG TCAACAGCAACTGATGGAAACCAGCCATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATATCGACGGTTTCC ATATGGGGATTGGTGGCGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTACAGCTGAGCGCCGGTCGCTACCATTAC CAGTTGGTCTGGTGTCAAAAA
lacZ_a TTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCC CTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGG G
lacZ_a2 ATGACCATGATTACGCCAAGCTATTTAGGTGACACTATAGAATACTCAAGCTATGCATCAAGCTTGGTACCGAGCTCGGA TCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTAAGGGCGAATTCTGCAGATATCCATCACACTGGCGGCCGC TCGAGCATGCATCTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGT GACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGA GGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTA
lacY ATGTACTATTTAAAAAACACAAACTTTTGGATGTTCGGTTTATTCTTTTTCTTTTACTTTTTTATCATGGGAGCCTACTT CCCGTTTTTCCCGATTTGGCTACATGACATCAACCATATCAGCAAAAGTGATACGGGTATTATTTTTGCCGCTATTTCTC TGTTCTCGCTATTATTCCAACCGCTGTTTGGTCTGCTTTCTGA
firefly_Luciferase ATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAACCGCTGGAGAGCAACTGCA TAAGGCTATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGGACATCACTTACG CTGAGTACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGCTGAATACAAATCACAGAATCGTCGTA TGCAGTGAAAACTCTCTTCAATTCTTTATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGA CATTTATAATGAACGTGAATTGCTCAACAGTATGGGCATTTCGCAGCCTACCGTGGTGTTCGTTTCCAAAAAGGGGTTGC AAAAAATTTTGAACGTGCAAAAAAAGCTCCCAATCATCCAAAAAATTATTATCATGGATTCTAAAACGGATTACCAGGGA TTTCAGTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTGCCAGAGTCCTTCGA TAGGGACAAGACAATTGCACTGATCATGAACTCCTCTGGATCTACTGGTCTGCCTAAAGGTGTCGCTCTGCCTCATAGAA CTGCCTGCGTGAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAATCAAATCATTCCGGATACTGCGATTTTAAGTGTT GTTCCATTCCATCACGGTTTTGGAATGTTTACTACACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAG ATTTGAAGAAGAGCTGTTTCTGAGGAGCCTTCAGGATTACAAGATTCAAAGTGCGCTGCTGGTGCCAACCCTATTCTCCT TCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTTACACGAAATTGCTTCTGGTGGCGCTCCCCTCTCT AAGGAAGTCGGGGAAGCGGTTGCCAAGAGGTTCCATCTGCCAGGTATCAGGCAAGGATATGGGCTCACTGAGACTACATC AGCTATTCTGATTACACCCGAGGGGGATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAAGCGAAGGTTG TGGATCTGGATACCGGGAAAACGCTGGGCGTTAATCAAAGAGGCGAACTGTGTGTGAGAGGTCCTATGATTATGTCCGGT TATGTAAACAATCCGGAAGCGACCAACGCCTTGATTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGA CGAAGACGAACACTTCTTCATCGTTGACCGCCTGAAGTCTCTGATTAAGTACAAAGGCTATCAGGTGGCTCCCGCTGAAT TGGAATCCATCTTGCTCCAACACCCCAACATCTTCGACGCAGGTGTCGCAGGTCTTCCCGACGATGACGCCGGTGAACTT CCCGCCGCCGTTGTTGTTTTGGAGCACGGAAAGACGATGACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAAC AACCGCGAAAAAGTTGCGCGGAGGAGTTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAAACTCGACGCAAGAA AAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATCGCCGTGTAA
SEAP ATGCTGCTGCTGCTGCTGCTGCTGGGCCTGAGGCTACAGCTCTCCCTGGGCATCATCCCAGTTGAGGAGGAGAACCCGGA CTTCTGGAACCGCGAGGCAGCCGAGGCCCTGGGTGCCGCCAAGAAGCTGCAGCCTGCACAGACAGCCGCCAAGAACCTCA TCATCTTCCTGGGCGATGGGATGGGGGTGTCTACGGTGACAGCTGCCAGGATCCTAAAAGGGCAGAAGAAGGACAAACTG GGGCCTGAGATACCCCTGGCCATGGACCGCTTCCCATATGTGGCTCTGTCCAAGACATACAATGTAGACAAACATGTGCC AGACAGTGGAGCCACAGCCACGGCCTACCTGTGCGGGGTCAAGGGCAACTTCCAGACCATTGGCTTGAGTGCAGCCGCCC GCTTTAACCAGTGCAACACGACACGCGGCAACGAGGTCATCTCCGTGATGAATCGGGCCAAGAAAGCAGGGAAGTCAGTG GGAGTGGTAACCACCACACGAGTGCAGCACGCCTCGCCAGCCGGCACCTACGCCCACACGGTGAACCGCAACTGGTACTC GGACGCCGACGTGCCTGCCTCGGCCCGCCAGGAGGGGTGCCAGGACATCGCTACGCAGCTCATCTCCAACATGGACATTG ACGTGATCCTAGGTGGAGGCCGAAAGTACATGTTTCGCATGGGAACCCCAGACCCTGAGTACCCAGATGACTACAGCCAA GGTGGGACCAGGCTGGACGGGAAGAATCTGGTGCAGGAATGGCTGGCGAAGCGCCAGGGTGCCCGGTATGTGTGGAACCG CACTGAGCTCATGCAGGCTTCCCTGGACCCGTCTGTGACCCATCTCATGGGTCTCTTTGAGCCTGGAGACATGAAATACG AGATCCACCGAGACTCCACACTGGACCCCTCCCTGATGGAGATGACAGAGGCTGCCCTGCGCCTGCTGAGCAGGAACCCC CGCGGCTTCTTCCTCTTCGTGGAGGGTGGTCGCATCGACCATGGTCATCATGAAAGCAGGGCTTACCGGGCACTGACTGA GACGATCATGTTCGACGACGCCATTGAGAGGGCGGGCCAGCTCACCAGCGAGGAGGACACGCTGAGCCTCGTCACTGCCG ACCACTCCCACGTCTTCTCCTTCGGAGGCTACCCCCTGCGAGGGAGCTCCATCTTCGGGCTGGCCCCTGGCAAGGCCCGG GACAGGAAGGCCTACACGGTCCTCCTATACGGAAACGGTCCAGGCTATGTGCTCAAGGACGGCGCCCGGCCGGATGTTAC CGAGAGCGAGAGCGGGAGCCCCGAGTATCGGCAGCAGTCAGCAGTGCCCCTGGACGAAGAGACCCACGCAGGCGAGGACG TGGCGGTGTTCGCGCGCGGCCCGCAGGCGCACCTGGTTCACGGCGTGCAGGAGCAGACCTTCATAGCGCACGTCATGGCC TTCGCCGCCTGCCTGGAGCCCTACACCGCCTGCGACCTGGCGCCCCCCGCCGGCACCACCGACGCCGCGCACCCGGGTTA CTCTAGAGTCGGGGCGGCCGGCCGCTTCGAGCAGACATGA
CBP AAACGTCGTTGGAAAAAGAATTTCATAGCCGTCTCAGCAGCCAACCGCTTTAAGAAAATCTCATCCTCCGGAGCACTT
truncVP22 ACGGCGCCAACCCGATCCAAGACACCCGCGCAGGGGCTGGCCAGAAAGCTGCACTTTAGCACCGCCCCCCCAAACCCCGA CGCGCCATGGACCCCCCGGGTGGCCGGCTTTAACAAGCGCGTCTTCTGCGCCGCGGTCGGGCGCCTGGCGGCCATGCATG CCCGGATGGCGGCTGTCCAGCTCTGGGACATGTCGCGTCCGCGCACAGACGAAGACCTCAACGAACTCCTTGGCATCACC ACCATCCGCGTGACGGTCTGCGAGGGCAAAAACCTGCTTCAGCGCGCCAACGAGTTGGTGAATCCAGACGTGGTGCAGGA CGTCGACGCGGCCACGGCGACTCGAGGGCGTTCTGCGGCGTCGCGCCCCACCGAGCGACCTCGAGCCCCAGCCCGCTCCG CTTCTCGCCCCAGACGGCCCGTCGAG
Xpress_EK GATCTGTACGACGATGACGATAAG
IgK_secretion ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGAC
3x_c_myc GAGCAGAAACTCATCTCTGAAGAAGATCTGGAACAAAAGTTGATTTCAGAAGAAGATCTGGAACAGAAGCTCATCTCTGA GGAAGATCTG
c_myc GAACAAAAACTCATCTCAGAAGAGGATCTG
c_myc GCATCAATGCAGAAGCTGATCTCAGAGGAGGACCTG
13xMyc TTAACGGTGAACAAAAGCTAATCTCCGAGGAAGACTTGAACGGTGAACAAAAATTAATCTCAGAAGAAGACTTGAACGGA CTCGACGGTGAACAAAAGTTGATTTCTGAAGAAGATTTGAACGGTGAACAAAAGCTAATCTCCGAGGAAGACTTGAACGG TGAACAAAAATTAATCTCAGAAGAAGACTTGAACGGACTCGACGGTGAACAAAAGTTGATTTCTGAAGAAGATTTGAACG GTGAACAAAAGCTAATCTCCGAGGAAGACTTGAACGGTGAACAAAAATTAATCTCAGAAGAAGACTTGAACGGACTCGAC GGTGAACAAAAGTTGATTTCTGAAGAAGATTTGAACGGTGAACAAAAGCTAATCTCCGAGGAAGACTTGAACGGTGAACA AAAATTAATCTCAGAAGAAGACTTGAACGGACTCGACGGTGAACAAAAGTTGATTTCTGAAGAAGATTTGAACGGTGAAC AAAAGCTAATCTCCGAGGAAGACTTGAACGGTGAACAAAAATTAATCAATCAC
T7_leader ATGGCTAGCATGACTGGTGGACAGCAAATGGGT
6xHis CATCATCACCATCACCAT
6xHis CATCATCATCATCATCAT
6xHN CATAATCATAATCATAATCATAATCATAATCACAAC
polyhis_Xpress_EK ATGGGGGGTTCTCATCATCATCATCATCATGGTATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGGGATCTGTACGA CGATGACGATAAGGTACCTAAGGATCAGCTTGGAGTTGATCC
V5 GGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACG
protA_analogue GACAACAAATTCAACAAAGAACAACAAAACGCGTTCTATGAGATCTTACATTTACCTAACTTAAACGAAGAACAACGAAA CGCCTTCATCCAAAGTTTAAAAGATGACCCAAGCCAAAGCGCTAACCTTTTAGCAGAAGCTAAAAAGCTAAATGATGCTC AGGCGCCGAAAGTAGACAACAAATTCAACAAAGAACAACAAAACGCGTTCTATGAGATCTTACATTTACCTAACTTAAAC GAAGAACAACGAAACGCCTTCATCCAAAGTTTAAAAGATGACCCAAGCCAAAGCGCTAACCTTTTAGCAGAAGCTAAAAA GCTAAATGATGCTCAGGCGCCGAAAGTA
protA_E_domain GCGCAACACGATGAAGCCGTA
GST ATGTCCCCTATACTAGGTTATTGGAAAATTAAGGGCCTTGTGCAACCCACTCGACTTCTTTTGGAATATCTTGAAGAAAA ATATGAAGAGCATTTGTATGAGCGCGATGAAGGTGATAAATGGCGAAACAAAAAGTTTGAATTGGGTTTGGAGTTTCCCA ATCTTCCTTATTATATTGATGGTGATGTTAAATTAACACAGTCTATGGCCATCATACGTTATATAGCTGACAAGCACAAC ATGTTGGGTGGTTGTCCAAAAGAGCGTGCAGAGATTTCAATGCTTGAAGGAGCGGTTTTGGATATTAGATACGGTGTTTC GAGAATTGCATATAGTAAAGACTTTGAAACTCTCAAAGTTGATTTTCTTAGCAAGCTACCTGAAATGCTGAAAATGTTCG AAGATCGTTTATGTCATAAAACATATTTAAATGGTGATCATGTAACCCATCCTGACTTCATGTTGTATGACGCTCTTGAT GTTGTTTTATACATGGACCCAATGTGCCTGGATGCGTTCCCAAAATTAGTTTGTTTTAAAAAACGTATTGAAGCTATCCC ACAAATTGATAAGTACTTGAAATCCAGCAAGTATATAGCATGGCCTTTGCAGGGCTGGCAAGCCACGTTTGGTGGTGGCG ACCATCCTCCAAAATCGGATCTGGAAGTTCTGTTCCAGGGGCCCCTGGGATCCCCGGAATTCCCGGGTCGACTCGAGCGG CCGCATCGTGACTGA
biotin_Pinpoint_Xa-1 ATGAAACTGAAGGTAACAGTCAACGGCACTGCGTATGACGTTGACGTTGACGTCGACAAGTCACACGAAAACCCGATGGG CACCATCCTGTTCGGCGGCGGCACCGGCGGCGCGCCGGCACCGGCAGCAGGTGGCGCAGGCGCCGGTAAGGCCGGAGAGG GCGAGATTCCCGCTCCGCTGGCCGGCACCGTCTCCAAGATCCTCGTGAAGGAGGGTGACACGGTCAAGGCTGGTCAGACC GTGCTCGTTCTCGAGGCCATGAAGATGGAGACCGAGATCAACGCTCCCACCGACGGCAAGGTCGAGAAGGTCCTGGTCAA GGAGCGTGACGCGGTGCAGGGCGGTCAGGGTCTCATCAAGATCGGGGATCTCGAGCTCATCGAAGG
Gal4_DBD ATGAAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAACCGAA GTGCGCCAAGTGTCTGAAGAACAACTGGGAGTGTCGCTACTCTCCCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATC TGACAGAAGTGGAATCAAGGCTAGAAAGACTGGAACAGCTATTTCTACTGATTTTTCCTCGAGAAGACCTTGACATGATT TTGAAAATGGATTCTTTACAGGATATAAAAGCATTGTTAACAGGATTATTTGTACAAGATAATGTGAATAAAGATGCCGT CACAGATAGATTGGCTTCAGTGGAGACTGATATGCCTCTAACATTGAGACAGCATAGAATAAGTGCGACATCATCATCGG AAGAGAGTAGTAACAAAGGTCAAAGACAGTTGACTGTATCG
5xGal4_DBD TCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGG AGTACTGTCCTCCG
Gal4_AD AATTTTAATCAAAGTGGGAATATTGCTGATAGCTCATTGTCCTTCACTTTCACTAACAGTAGCAACGGTCCGAACCTCAT AACAACTCAAACAAATTCTCAAGCGCTTTCACAACCAATTGCCTCCTCTAACGTTCATGATAACTTCATGAATAATGAAA TCACGGCTAGTAAAATTGATGATGGTAATAATTCAAAACCACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGCG TTTGGAATCACTACAGGGATGTTTAATACCACTACAATGGATGATGTATATAACTATCTATTCGATGATGAAGATACCCC ACCAAACCCAAAAAAAGAG
VP16_AD GCCCCCCCGACCGATGTCAGCCTGGGGGACGAGCTCCACTTAGACGGCGAGGACGTGGCGATGGCGCATGCCGACGCGCT AGACGATTTCGATCTGGACATGTTGGGGGACGGGGATTCCCCGGGTCCGGGATTTACCCCCCACGACTCCGCCCCCTACG GCGCTCTGGATATGGCCGACTTCGAGTTTGAGCAGATGTTTACCGATGCCCTTGGAATTGACGAGTACGGTGGG
VP16_AD ATGGGCCCTAAAAAGAAGCGTAAAGTCGCCCCCCCGACCGATGTCAGCCTGGGGGACGAGCTTCACTTAAACGGCGAGGA CGTGGCGATGGCGCATGCCGACGCGCTAGACGATTTCGATCTGGACATGTTGGGGGACGGGGATTCCCCGGGTCCGGGAT TTACCCCCCACGACTCCGCCCCCTACGGCGCTCTGGATATGGCCGACTTCGAGTTTGAGCAGATGTTTACCGATGCCCTT GGAATTGACGAGTACGGTGGGGAATTC
LexA_DBD ATGAAAGCGTTAACGGCCAGGCAACAAGAGGTGTTTGATCTCATCCGTGATCACATCAGCCAGACAGGTATGCCGCCGAC GCGTGCGGAAATCGCGCAGCGTTTGGGGTTCCGTTCCCCAAACGCGGCTGAAGAACATCTGAAGGCGCTGGCACGCAAAG GCGTTATTGAAATTGTTTCCGGCGCATCACGCGGGATTCGTCTGTTGCAGGAAGAGGAAGAAGGGTTGCCGCTGGTAGGT CGTGTGGCTGCCGGTGAACCACTTCTGGCGCAACAGCATATTGAAGGTCATTATCAGGTCGATCCTTCCTTATTCAAGCC GAATGCTGATTTCCTGCTGCGCGTCAGCGGGATGTCGATGAAAGATATCGGCATTATGGATGGTGACTTGCTGGCAGTGC ATAAAACTCAGGATGTACGTAACGGTCAGGTCGTTGTCGCACGTATTGATGACGAAGTTACCGTTAAGCGCCTGAAAAAA CAGGGCAATAAAGTCGAACTGTTGCCAGAAAATAGCGAGTTTAAACCAATTGTCGTAGATCTTCGTCAGCAGAGCTTCAC CATTGAAGGGCTGGCGGTTGGGGTTATTCGCAACGGCGACTGGCTGGAATTCCCGGGGATCCGTCGACCATGGCGGCCGC TCGAGTCGACCTGCAGCCAAGCTAATTCCGGGCGAATTTCTTATGATTTATGA
Gal4_AD ATGGATAAAGCGGAATTAATTCCCGAGCCTCCAAAAAAGAAGAGAAAGGTCGAATTGGGTACCGCCGCCAATTTTAATCA AAGTGGGAATATTGCTGATAGCTCATTGTCCTTCACTTTCACTAACAGTAGCAACGGTCCGAACCTCATAACAACTCAAA CAAATTCTCAAGCGCTTTCACAACCAATTGCCTCCTCTAACGTTCATGATAACTTCATGAATAATGAAATCACGGCTAGT AAAATTGATGATGGTAATAATTCAAAACCACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGCGTTTGGAATCAC TACAGGGATGTTTAATACCACTACAATGGATGATGTATATAACTATCTATTCGATGATGAAGATACCCCACCAAACCCAA AAAAAGAG
NF-KB_AD GTGTTTCCTTCTGGGCAGATCTCAAACCAGGCCCTGGCCTTAGCACCGTCCTCTGCCCCAGTCCTTGCCCAGACCATGGT CCCTTCCTCAGCCATGGTACCTCTGGCTCAGCCCCCAGCTCCTGCCCCAGTTCTAACCCCGGGTCCTCCCCAGTCCCTGT CTGCACCTGTTCCAAAGAGCACCCAGGCTGGGGAAGGCACGCTGTCGGAAGCCCTGCTGCACCTGCAGTTTGATGCTGAT GAAGACTTGGGGGCCTTGCTTGGCAACAGCACAGACCCAGGAGTGTTCACAGACCTGGCATCTGTGGACAACTCAGAGTT TCAGCAGCTCCTGAACCAGGGTGTGTCCATGTCTCACTCCACAGCTGAGCCCATGCTGATGGAGTACCCTGAAGCTATAA CTCGCCTGGTGACAGGGTCCCAGAGGCCCCCTGACCCAGCTCCCACACCCCTGGGGACCTCGGGGCTTCCCAATGGTCTC TCCGGAGATGAAGACTTCTCCTCCATTGCGGACATGGACTTCTCTGCTCTGCTGAGTCAGATCAGCTCCAGCGGCCAA
MAPKK_NES ATGAACCTGGTGGACCTCCAAAAGAAGCTGGAGGAGCTGGAGCTGGACGAGCAGCAG
HIV_Rev_NES CTACCACCGCTTGAGAGACTTACTCTTGAT
SV40_NLS AGCAGCCTGAGGCCTCCTAAGAAGAAGAGGAAGGTT
SV40_NLS GCGGAATTAATTCCCGAGCCTCCAAAAAAGAAGAGAAAGGTCGAATTGGGTACCGCC
NLS_tandem_repeat GATCCAAAAAAGAAGAGAAAGGTAGATCCAAAAAAGAAGAGAAAGGTAGATCCAAAAAAGAAGAGAAAGGTAGGATCCAC CGGATCTAGA
rhoB_GTPase CGGAAGAAACTGGTGGTTGTTGGTGATGGAGCCTGTGGAAAGACATGCTTGCTCATAGTCTTCAGCAAGGACGAGTTCCC AGAGGTGTATGTGCCCACAGTGTTTGAGAACTATGTGGCAGATATCGAGGTGGATGGAAAGCAGGTAGAGTTGGCTTTGT GGGACACAGCTGGCCAGGAGGACTACGACCGCCTGCGGCCGCTCTCCTACCCGGACACCGACGTCATTCTCATGTGCTTC TCGGTGGACAGCCCGGACTCGCTGGAGAACATCCCCGAGAAGTGGGTCCCCGAGGTGAAGCACTTCTGTCCCAATGTGCC CATCATCCTGGTGGCCAACAAAAAAGACCTGCGCAGCGACGAGCATGTCCGCACAGAGCTGGCCCGCATGAAGCAGGAAC CCGTTCGCACGGATGACGGCCGCGCCATGGCCGTGCGCATCCAAGCCTACGACTACCTCGAGTGCTCTGCCAAGACCAAG GAAGGCGTGCGCGAGGTCTTCGAG
hCyto_b_actin ATGGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGCCGGCTTCGCGGGCGACGATGCCCC CCGGGCCGTCTTCCCCTCCATCGTGGGGCGCCCCAGGCACCAGGGCGTGATGGTGGGCATGGGTCAGAAGGATTCCTATG TGGGCGACGAGGCCCAGAGCAAGAGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGAC GACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCTCCCGAGGAGCACCCCGTGCTGCTGACCGA GGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACG TTGCTATCCAGGCTGTGCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACC CACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACTGA CTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGG AGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAAGAGATGGCCACGGCTGCTTCCAGCTCCTCCCTGGAGAAGAGCTAC GAGCTGCCTGACGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGCTGCCCTGAGGCACTCTTCCAGCCTTCCTTCCT GGGCATGGAGTCCTGTGGCATCCACGAAACTACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGT ACGCCAACACAGTGCTGTCTGGCGGCACCACCATGTACCCTGGCATTGCCGACAGGATGCAGAAGGAGATCACTGCCCTG GCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGGATCGGCGGCTCCATCCTGGC CTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGACGAGTCCGGCCCCTCCATCGTCCACCGCAAAT GCTTCTAG
calreticulin_targeting ATGCTGCTATCCGTGCCGTTGCTGCTCGGCCTCCTCGGCCTGGCCGTCGCC
c-Ha-Ras_farnesylation AAGCTGAACCCTCCTGATGAGAGTGGCCCCGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTG
peroximal_target_signal1 TCCAAGCTGTAG
h_beta_1_4_GT ATGAGGCTTCGGGAGCCGCTCCTGAGCGGCAGCGCCGCGATGCCAGGCGCGTCCCTACAGCGGGCCTGCCGCCTGCTCGT GGCCGTCTGCGCTCTGCACCTTGGCGTCACCCTCGTTTACTACCTGGCTGGCCGCGACCTGAGCCGCCTGCCCCAACTGG TCGGAGTCTCCACACCGCTGCAGGGCGGCTCGAACAGTGCCGCCGCCATCGGGCAGTCCTCCGGGGAGCTCCGGACCGGA GGGGCC
neuromodulin ATGCTGTGCTGTATGAGAAGAACCAAACAGGTTGAAAAGAATGATGAGGACCAAAAGATC
mito_targeting ATGTCCGTCCTGACGCCGCTGCTGCTGCGGGGCTTGACAGGCTCGGCCCGGCGGCTCCCAGTGCCGCGCGCCAAGATCCA TTCGTTG
h_a-tubulin GTGCGTGAGTGCATCTCCATCCACGTTGGCCAGGCTGGTGTCCAGATTGGCAATGCCTGCTGGGAGCTCTACTGCCTGGA ACACGGCATCCAGCCCGATGGCCAGATGCCAAGTGACAAGACCATTGGGGGAGGAGATGACTCCTTCAACACCTTCTTCA GTGAGACGGGCGCTGGCAAGCACGTGCCCCGGGCTGTGTTTGTAGACTTGGAACCCACAGTCATTGATGAAGTTCGCACT GGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTATGCCCGAGGGCA CTACACCATTGGCAAGGAGATCATTGACCTTGTGTTGGACCGAATTCGCAAGCTGGCTGACCAGTGCACCGGTCTTCAGG GCTTCTTGGTTTTCCACAGCTTTGGTGGGGGAACTGGTTCTGGGTTCACCTCCCTGCTCATGGAACGTCTCTCAGTTGAT TATGGCAAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCACCCCAGGTTTCCACAGCTGTAGTTGAGCCCTACAACTC CATCCTCACCACCCACACCACCCTGGAGCACTCTGATTGTGCCTTCATGGTAGACAATGAGGCCATCTATGACATCTGTC GTAGAAACCTCGATATCGAGCGCCCAACCTACACTAACCTTAACCGCCTTATTAGCCAGATTGTGTCCTCCATCACTGCT TCCCTGAGATTTGATGGAGCCCTGAATGTTGACCTGACAGAATTCCAGACCAACCTGGTGCCCTACCCCCGCATCCACTT CCCTCTGGCCACATATGCCCCTGTCATCTCTGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCAGAGATCACCAATG CTTGCTTTGAGCCAGCCAACCAGATGGTGAAATGTGACCCTCGCCATGGTAAATACATGGCTTGCTGCCTGTTGTACCGT GGTGACGTGGTTCCCAAAGATGTCAATGCTGCCATTGCCACCATCAAAACCAAGCGCAGCATCCAGTTTGTGGATTGGTG CCCCACTGGCTTCAAGGTTGGCATCAACTACCAGCCTCCCACTGTGGTGCCTGGTGGAGACCTGGCCAAGGTACAGAGAG CTGTGTGCATGCTGAGCAACACCACAGCCATTGCTGAGGCCTGGGCTCGCCTGGACCACAAGTTTGACCTGATGTATGCC AAGCGTGCCTTTGTTCACTGGTACGTGGGTGAGGGGATGGAGGAAGGCGAGTTTTCAGAGGCCCGTGAAGATATGGCTGC CCTTGAGAAGGATTATGAGGAGGTTGGTGTGGATTCTGTTGAAGGAGAGGGTGAGGAAGAAGGAGAGGAATACTAA
cosN CCGTAACCTGTCGGATCACCGGAAAGGACCCGTAAAGTGATAATGATTATCATCTACATATCACAACGTGCGTGGAGGCC ATCAAACCAC
FlpRec ATGCCACAATTTGATATATTATGTAAAACACCACCTAAGGTGCTTGTTCGTCAGTTTGTGGAAAGGTTTGAAAGACCTTC AGGTGAGAAAATAGCATTATGTGCTGCTGAACTAACCTATTTATGTTGGATGATTACACATAACGGAACAGCAATCAAGA GAGCCACATTCATGAGCTATAATACTATCATAAGCAATTCGCTGAGTTTGGATATTGTCAACAAGTCACTGCAGTTTAAA TACAAGACGCAAAAAGCAACAATTCTGGAAGCCTCATTAAAGAAATTGATTCCTGCTTGGGAATTTACAATTATTCCTTA CTATGGACAAAAACATCAATCTGATATCACTGATATTGTAAGTAGTTTGCAATTACAGTTCGAATCATCGGAAGAAGCAG ATAAGGGAAATAGCCACAGTAAAAAAATGCTTAAAGCACTTCTAAGTGAGGGTGAAAGCATCTGGGAGATCACTGAGAAA ATACTAAATTCGTTTGAGTATACTTCGAGATTTACAAAAACAAAAACTTTATACCAATTCCTCTTCCTAGCTACTTTCAT CAATTGTGGAAGATTCAGCGATATTAAGAACGTTGATCCGAAATCATTTAAATTAGTCCAAAATAAGTATCTGGGAGTAA TAATCCAGTGTTTAGTGACAGAGACAAAGACAAGCGTTAGTAGGCACATATACTTCTTTAGCGCAAGGGGTAGGATCGAT CCACTTGTATATTTGGATGAATTTTTGAGGAATTCTGAACCAGTCCTAAAACGAGTAAATAGGACCGGCAATTCTTCAAG CAACAAGCAGGAATACCAATTATTAAAAGATAACTTAGTCAGATCGTACAACAAAGCTTTGAAGAAAAATGCGCCTTATT CAATCTTTGCTATAAAAAATGGCCCAAAATCTCACATTGGAAGACATTTGATGACCTCATTTCTTTCAATGAAGGGCCTA ACGGAGTTGACTAATGTTGTGGGAAATTGGAGCGATAAGCGTGCTTCTGCCGTGGCCAGGACAACGTATACTCATCAGAT AACAGCAATACCTGATCACTACTTCGCACTAGTTTCTCGGTACTATGCATATGATCCAATATCAAAGGAAATGATAGCAT TGAAGGATGAGACTAATCCAATTGAGGAGTGGCAGCATATAGAACAGCTAAAGGGTAGTGCTGAAGGAAGCATACGATAC CCCGCATGGAATGGGATAATATCACAGGAGGTACTAGACTACCTTTCATCCTACATAAATAGACGCATATAA
CRE_NLS ATGGCACCCAAGAAGAAGAGGAAGGTGTCCAATTTACTGACCGTACACCAAAATTTGCCTGCATTACCGGTCGATGCAAC GAGTGATGAGGTTCGCAAGAACCTGATGGACATGTTCAGGGATCGCCAGGCGTTTTCTGAGCATACCTGGAAAATGCTTC TGTCCGTTTGCCGGTCGTGGGCGGCATGGTGCAAGTTGAATAACCGGAAATGGTTTCCCGCAGAACCTGAAGATGTTCGC GATTATCTTCTATATCTTCAGGCGCGCGGTCTGGCAGTAAAAACTATCCAGCAACATTTGGGCCAGCTAAACATGCTTCA TCGTCGGTCCGGGCTGCCACGACCAAGTGACAGCAATGCTGTTTCACTGGTTGTGCGGCGGATCCGAAAAGAAAACGTTG ATGCCGGTGAACGTGCAAAACAGGCTCTAGCGTTCGAACGCACTGATTTCGACCAGGTTCGTTCACTCATGGAAAATAGC GATCGCTGCCAGGATATACGTAATCTGGCATTTCTGGGGATTGCTTATAACACCCTGTTACGTATAGCCGAAATTGCCAG GATCAGGGTTAAAGATATCTCACGTACTGACGGTGGGAGAATGTTAATCCATATTGGCAGAACGAAAACGCTGGTTAGCA CCGCAGGTGTAGAGAAGGCACTTAGCCTGGGGGTAACTAAACTGGTCGAGCGATGGATTTCCGTCTCTGGTGTAGCTGAT GATCCGAATAACTACCTGTTTTGCCGGGTCAGAAAAAATGGTGTTGCCGCGCCATCTGCCACCAGCCAGCTATCAACTCG CGCCCTGGAAGGGATTTTTGAAGCAACTCATCGATTGATTTACGGCGCTAAGGATGACTCTGGTCAGAGATACCTGGCCT GGTCTGGACACAGTGCCCGTGTCGGAGCCGCGCGAGATATGGCCCGCGCTGGAGTTTCAATACCGGAGATCATGCAAGCT GGTGGCTGGACCAATGTAAATATTGTCATGAACTATATCCGTAACCTGGATAGTGAAACAGGGGCAATGGTGCGCCTGCT GCAAGATGGCGATTAG
psi_plus_pack CCAGCAACTTATCTGTGTCTGTCCGATTGTCTAGTGTCTATGTTTGATGTTATGCGCCTGCGTCTGTACTAGTTAGCTAA CTAGCTCTGTATCTGGCGGACCCGTGGTGGAACTGACGAGTTCTGAACACCCGGCCGCAACCCTGGGAGACGTCCCAGGG ACTTTGGGGGCCGTTTTTGTGGCCCGACCTGAGGAAGGGAGTCGATGTGGAATCCGACCCCGTCAGGATATGTGGTTCTG GTAGGAGACGAGAACCTAAAACAGTTCCCGCCTCCGTCTGAATTTTTGCTTTCGGTTTGGAACCGAAGCCGCGCGTCTTG TCTGCTGCAGCGCTGCAGCATCGTTCTGTGTTGTCTCTGTCTGACTGTGTTTCTGTATTTGTCTGAAAATTAGGGCCAGA CTGTTACCACTCCCTTAAGTTTGACCTTAGGTCACTGGAAAGATGTCGAGCGGATCGCTCACAACCAGTCGGTAGATGTC AAGAAGAGACGTTGGGTTACCTTCTGCTCTGCAGAATGGCCAACCTTTAACGTCGGATGGCCGCGAGACGGCACCTTTAA CCGAGACCTCATCACCCAGGTTAAGATCAAGGTCTTTTCACCTGGCCCGCATGGACACCCAGACCAGGTCCCCTACATCG TGACCTGGGAAGCCTTGGCTTTTGACCCCCCTCCCTGGGTCAAGCCCTTTGTACACCCTAAGCCTCCGCCTCCTCTTCCT CCATCCGCCCCGTCTCTCCCCCTTGAACCTCCTCGTTCGACCCCGCCTCGATCCTCCCTTTATCCAGCCCTCACTCCTTC TCTAGGCGCC
repA4 ATGCACCTCCCACCGCAAGCGGCGGGCCCCGACCGGAGCCACTTTAGTTACAACACACAAAAACAACCTCCAGAAAAACC CCGGTCCAGCGCAGAACCGAAACCACAAAGCCCCTCCCTCATAACTGAAAAGCGGCCCCGCCCCGGCCCAAAGGGCCGGA ACAGAGTCGCTTTTAATTATGAATGTTGTAACTACATCTTCATCGCTGTCAGTCTTCTCGCTGGAAGTTCTCAGTACACG CTCGTAAGCGGCCCTCACGGCCCGCTAACGCGGAGACACGCCCCGACTTCGGGTAAACCCTCGTCGGGACCACTCCGACC GCGCACAGAAGCTCTCTCATGGCTGAAAGCGGGTATGGTCTGGCAGGGCTGGGGATGGGTAAGGTGA
loxP ATAACTTCGTATAGCATACATTATACGAAGTTAT
loxH ATTACCTCATATAGCATACATTATACGAAGTTAT
incA ATGTTTTGGGTTTTAAGTGGGTTTGTTTGTCAAGTTTACCCCATTTCAACCATCAATCAATGA
stbA ATGTTGGTATTCATTGATGACGGTTCAACAAACATCAAACTACAGTGGCAGGAAAGCGACGGAACAATTAAACAGCACAT TAGCCCGAACAGCTTCAAACGCGAGTGGGCAGTCCCTTTTGGTGATAAAAAGGTCTTTAACTACACACTGAACGGCGAAC AGTATTCATTTGATCCAACCAGCCCGGATGCTGTAGTCACAACCAATATCGCATGGCAATACAGCGACGTTAATGTCGTT GCAGTGCATCACGCCTTACTGACCAGTGGTCTGCCGGTAAGCGAAGTGGATATTGTTTGCACACTTCCTCTGACAGAGTA TTACGACAGAAATAACCAACCCAATACGGAAAATATTGAGCGTAAGAAAGCAAACTTCCGGAAAAAAATTACATTAAATG GCGGGGATACATTCACAATAAAAGATGTAAAAGTCATGCCTGAATCTATACCGGCAGGTTATGAAGTTCTACAAGAACTG GATGAGTTAGATTCTTTATTAATTATAGATCTCGGGGGCACCACATTAGATATTTCTCAGGTAATGGGGAAATTATCGGG GATCAGTAAAATATACGGAGACTCATCTCTTGGTGTCTCTCTGGTTACATCTGCAGTAAAAGATGCCCTTTCTCTTGCGA GAACAAAAGGAAGTAGCTATCTTGCTGACGATATAATCATTCACAGAAAAGATAATAACTATCTGAAGCAACGAATTAAT GATGAGAACAAAATATCAATAGTCACCGAAGCAATGAATGAAGCACTTCGTAAACTTGAGCAACGTGTATTAAATACGCT CAATGAATTTTCTGGTTATACTCATGTTATGGTTATAGGCGGTGGCGCAGAATTAATATGCGATGCAGTAAAAAAACACA CACAGATTCGTGATGAACGTTTTTTCAAAACCAATAACTCTCAATATGATTTAGTTAACGGTATGTATCTCATAGGTAAT TAA
stbB ATGATGGACAAGCGCAGAACCATTGCCTTCAAACTAAATCCAGATGTAAATCAAACAGATAAAATTGTTTGTGATACACT GGACAGTATCCCGCAAGGGGAACGAAGCCGCCTTAACCGGGCCGCACTGACGGCAGGTCTGGCCTTATACAGACAAGATC CCCGGACCCCTTTCCTTTTATGTGAGCTGCTGACGAAAGAAACCACATTTTCAGATATCGTGAATATATTGAGATCGCTA TTTCCAAAAGAGATGGCCGATTTTAATTCTTCAATAGTCACTCAATCCTCTTCACAACAAGAGCAAAAAAGTGATGAAGA GACCAAAAAAAATGCGACGAAGCTAATAAAATTAATTCAATTATTATTGAGTTCCCTTTATCCACTATCAGGCTGGATAA AGGGAACTCAATCAAGTTATTTTCTTACCAGTCATTACATAATCGTTATTATGAAATAA
VDE TATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATG
Tn7_att TGCCCCGCTTACGCAGGGCATCCATTTATTACTCAACCGTAACCGATTTTGCCAGGTTACGCGGC
LAAV-2_ITR CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCG GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT
RAAV-2_ITR AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCC CGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG
hGH_int TTCGAACAGGTAAGCGCCCCTAAAATCCCTTTGGCACAATGTGTCCTGAGGGGAGAGGCAGCGACCTGTAGATGGGACGG GGGCACTAACCCTCAGGGTTTGGGGTTCTGAATGTGAGTATCGCCATCTAAGCCCAGTATTTGGCCAATCTCAGAAAGCT CCTGGCTCCCTGGAGGATGGAGAGAGAAAAACAAACAGCTCCTGGAGCAGGGAGAGTGTTGGCCTCTTGCTCTCCGGCTC CCTCTGTTGCCCTCTGGTTTCTCCCCAGGTT
SV40_int GGTAAATATAAAATTT
SV40_late_19s_int GTAAGTTTAGTCTTTTTGTCTTTTATTTCAG
modSV40_late_16s_int GTAAGTTTAGTCTTTTTGTCTTTTATTTCAGGTCCCGGATCCGGTGGTGGTGCAAATCAAAGAACTGCTCCTCAGTGGAT GTTGCCTTTACTTCTAG
chim_int GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTT CTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAG
synth_int GAATTAATTCGCTGTCTGCGAGGGCCAGCTGTTGGGGTGAGTACTCCCTCTCAAAAGCGGGCATGACTTCTGCGCTAAGA TTGTCAGTTTCCAAAAACGAGGAGGATTTGATATTCACCTGGCCCGCGGTGATGCCTTTGAGGGTGGCCGCGTCCATCTG GTCAGAAAAGACAATCTTTTTGTTGTCAAGCTTGAGGTGTGGCAGGCTTGAGATCTGGCCATACACTTGAGTGACAATGA CATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGGTCG
bGlob_int CGAATCCCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGACGTAAGTACCGCCTATAGAGTCTAT AGGCCCACAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTT TCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCA ATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCT ACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGC TAATCATGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGC AAAGAATTGGGAT
bGlob_int GTGAGTTTGGGGACCCTTGATTGTTCTTTCTTTTTCGCTATTGTAAAATTCATGTTATATGGAGGGGGCAAAGTTTTCAG GGTGTTGTTTAGAATGGGAAGATGTCCCTTGTATCACCATGGACCCTCATGATAATTTTGTTTCTTTCACTTTCTACTCT GTTGACAACCATTGTCTCCTCTTATTTTCTTTTCATTTTCTGTAACTTTTTCGTTAAACTTTAGCTTGCATTTGTAACGA ATTTTTAAATTCACTTTTGTTTATTTGTCAGATTGTAAGTACTTTCTCTAATCACTTTTTTTTCAAGGCAATCAGGGTAT ATTATATTGTACTTCAGCACAGTTTTAGAGAACAATTGTTATAATTAAATGATAAGGTAGAATATTTCTGCATATAAATT CTGGCTGGCGTGGAAATATTCTTATTGGTAGAAACAACTACATCCTGGTCATCATCCTGCCTTTCTCTTTATGGTTACAA TGATATACACTGTTTGAGATGAGGATAAAATACTCTGAGTCCAAACCGGGCCCCTCTGCTAACCATGTTCATGCCTTCTT CTTTTTCCTACAG
AAV-2_rep CCATGCCGGGGTTTTACGAGATTGTGATTAAGGTCCCCAGCGACCTTGACGAGCATCTGCCCGGCATTTCTGACAGCTTT GTGAACTGGGTGGCCGAGAAGGAATGGGAGTTGCCGCCAGATTCTGACATGGATCTGAATCTGATTGAGCAGGCACCCCT GACCGTGGCCGAGAAGCTGCAGCGCGACTTTCTGACGGAATGGCGCCGTGTGAGTAAGGCCCCGGAGGCCCTTTTCTTTG TGCAATTTGAGAAGGGAGAGAGCTACTTCCACATGCACGTGCTCGTGGAAACCACCGGGGTGAAATCCATGGTTTTGGGA CGTTTCCTGAGTCAGATTCGCGAAAAACTGATTCAGAGAATTTACCGCGGGATCGAGCCGACTTTGCCAAACTGGTTCGC GGTCACAAAGACCAGAAATGGCGCCGGAGGCGGGAACAAGGTGGTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCA AAACCCAGCCTGAGCTCCAGTGGGCGTGGACTAATATGGAACAGTATTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAA CGGTTGGTGGCGCAGCATCTGACGCACGTGTCGCAGACGCAGGAGCAGAACAAAGAGAATCAGAATCCCAATTCTGATGC GCCGGTGATCAGATCAAAAACTTCAGCCAGGTACATGGAGCTGGTCGGGTGGCTCGTGGACAAGGGGATTACCTCGGAGA AGCAGTGGATCCAGGAGGACCAGGCCTCATACATCTCCTTCAATGCGGCCTCCAACTCGCGGTCCCAAATCAAGGCTGCC TTGGACAATGCGGGAAAGATTATGAGCCTGACTAAAACCGCCCCCGACTACCTGGTGGGCCAGCAGCCCGTGGAGGACAT TTCCAGCAATCGGATTTATAAAATTTTGGAACTAAACGGGTACGATCCCCAATATGCGGCTTCCGTCTTTCTGGGATGGG CCACGAAAAAGTTCGGCAAGAGGAACACCATCTGGCTGTTTGGGCCTGCAACTACCGGGAAGACCAACATCGCGGAGGCC ATAGCCCACACTGTGCCCTTCTACGGGTGCGTAAACTGGACCAATGAGAACTTTCCCTTCAACGACTGTGTCGACAAGAT GGTGATCTGGTGGGAGGAGGGGAAGATGACCGCCAAGGTCGTGGAGTCGGCCAAAGCCATTCTCGGAGGAAGCAAGGTGC GCGTGGACCAGAAATGCAAGTCCTCGGCCCAGATAGACCCGACTCCCGTGATCGTCACCTCCAACACCAACATGTGCGCC GTGATTGACGGGAACTCAACGACCTTCGAACACCAGCAGCCGTTGCAAGACCGGATGTTCAAATTTGAACTCACCCGCCG TCTGGATCATGACTTTGGGAAGGTCACCAAGCAGGAAGTCAAAGACTTTTTCCGGTGGGCAAAGGATCACGTGGTTGAGG TGGAGCATGAATTCTACGTCAAAAAGGGTGGAGCCAAGAAAAGACCCGCCCCCAGTGACGCAGATATAAGTGAGCCCAAA CGGGTGCGCGAGTCAGTTGCGCAGCCATCGACGTCAGACGCGGAAGCTTCGATCAACTACGCAGACAGGTACCAAAACAA ATGTTCTCGTCACGTGGGCATGAATCTGATGCTGTTTCCCTGCAGACAATGCGAGAGAATGAATCAGAATTCAAATATCT GCTTCACTCACGGACAGAAAGACTGTTTAGAGTGCTTTCCCGTGTCAGAATCTCAACCCGTTTCTGTCGTCAAAAAGGCG TATCAGAAACTGTGCTACATTCATCATATCATGGGAAAGGTGCCAGACGCTTGCACTGCCTGCGATCTGGTCAATGTGGA TTTGGATGACTGCATCTTTGAACAATAA
AAV-2_cap ATGGCTGCCGATGGTTATCTTCCAGATTGGCTCGAGGACACTCTCTCTGAAGGAATAAGACAGTGGTGGAAGCTCAAACC TGGCCCACCACCACCAAAGCCCGCAGAGCGGCATAAGGACGACAGCAGGGGTCTTGTGCTTCCTGGGTACAAGTACCTCG GACCCTTCAACGGACTCGACAAGGGAGAGCCGGTCAACGAGGCAGACGCCGCGGCCCTCGAGCACGACAAAGCCTACGAC CGGCAGCTCGACAGCGGAGACAACCCGTACCTCAAGTACAACCACGCCGACGCGGAGTTTCAGGAGCGCCTTAAAGAAGA TACGTCTTTTGGGGGCAACCTCGGACGAGCAGTCTTCCAGGCGAAAAAGAGGGTTCTTGAACCTCTGGGCCTGGTTGAGG AACCTGTTAAGACGGCTCCGGGAAAAAAGAGGCCGGTAGAGCACTCTCCTGTGGAGCCAGACTCCTCCTCGGGAACCGGA AAGGCGGGCCAGCAGCCTGCAAGAAAAAGATTGAATTTTGGTCAGACTGGAGACGCAGACTCAGTACCTGACCCCCAGCC TCTCGGACAGCCACCAGCAGCCCCCTCTGGTCTGGGAACTAATACGATGGCTACAGGCAGTGGCGCACCAATGGCAGACA ATAACGAGGGCGCCGACGGAGTGGGTAATTCCTCGGGAAATTGGCATTGCGATTCCACATGGATGGGCGACAGAGTCATC ACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAACCACCTCTACAAACAAATTTCCAGCCAATCAGGAGCCTC GAACGACAATCACTACTTTGGCTACAGCACCCCTTGGGGGTATTTTGACTTCAACAGATTCCACTGCCACTTTTCACCAC GTGACTGGCAAAGACTCATCAACAACAACTGGGGATTCCGACCCAAGAGACTCAACTTCAAGCTCTTTAACATTCAAGTC AAAGAGGTCACGCAGAATGACGGTACGACGACGATTGCCAATAACCTTACCAGCACGGTTCAGGTGTTTACTGACTCGGA GTACCAGCTCCCGTACGTCCTCGGCTCGGCGCATCAAGGATGCCTCCCGCCGTTCCCAGCAGACGTCTTCATGGTGCCAC AGTATGGATACCTCACCCTGAACAACGGGAGTCAGGCAGTAGGACGCTCTTCATTTTACTGCCTGGAGTACTTTCCTTCT CAGATGCTGCGTACCGGAAACAACTTTACCTTCAGCTACACTTTTGAGGACGTTCCTTTCCACAGCAGCTACGCTCACAG CCAGAGTCTGGACCGTCTCATGAATCCTCTCATCGACCAGTACCTGTATTACTTGAGCAGAACAAACACTCCAAGTGGAA CCACCACGCAGTCAAGGCTTCAGTTTTCTCAGGCCGGAGCGAGTGACATTCGGGACCAGTCTAGGAACTGGCTTCCTGGA CCCTGTTACCGCCAGCAGCGAGTATCAAAGACATCTGCGGATAACAACAACAGTGAATACTCGTGGACTGGAGCTACCAA GTACCACCTCAATGGCAGAGACTCTCTGGTGAATCCGGGCCCGGCCATGGCAAGCCACAAGGACGATGAAGAAAAGTTTT TTCCTCAGAGCGGGGTTCTCATCTTTGGGAAGCAAGGCTCAGAGAAAACAAATGTGGACATTGAAAAGGTCATGATTACA GACGAAGAGGAAATCAGGACAACCAATCCCGTGGCTACGGAGCAGTATGGTTCTGTATCTACCAACCTCCAGAGAGGCAA CAGACAAGCAGCTACCGCAGATGTCAACACACAAGGCGTTCTTCCAGGCATGGTCTGGCAGGACAGAGATGTGTACCTTC AGGGGCCCATCTGGGCAAAGATTCCACACACGGACGGACATTTTCACCCCTCTCCCCTCATGGGTGGATTCGGACTTAAA CACCCTCCTCCACAGATTCTCATCAAGAACACCCCGGTACCTGCGAATCCTTCGACCACCTTCAGTGCGGCAAAGTTTGC TTCCTTCATCACACAGTACTCCACGGGACAGGTCAGCGTGGAGATCGAGTGGGAGCTGCAGAAGGAAAACAGCAAACGCT GGAATCCCGAAATTCAGTACACTTCCAACTACAACAAGTCTGTTAATGTGGACTTTACTGTGGACACTAATGGCGTGTAT TCAGAGCCTCGCCCCATTGGCACCAGATACCTGACTCGTAATCTGTAATTGCTTGTTAATCAATAAACCGTTTAATTCGT TTCAGTTGAACTTTGGTCTCTGCGTATTTCTTTCTTATCTAGTTTCCATGGCTACGTAGATAAGTAGCATGGCGGGTTAA TCATTAACTACAGC
AdV_E2A GGTACCCAACTCCATGCTTAACAGTCCCCAGGTACAGCCCACCCTGCGTCGCAACCAGGAACAGCTCTACAGCTTCCTGG AGCGCCACTCGCCCTACTTCCGCAGCCACAGTGCGCAGATTAGGAGCGCCACTTCTTTTTGTCACTTGAAAAACATGTAA AAATAATGTACTAGGAGACACTTTCAATAAAGGCAAATGTTTTTATTTGTACACTCTCGGGTGATTATTTACCCCCCACC CTTGCCGTCTGCGCCGTTTAAAAATCAAAGGGGTTCTGCCGCGCATCGCTATGCGCCACTGGCAGGGACACGTTGCGATA CTGGTGTTTAGTGCTCCACTTAAACTCAGGCACAACCATCCGCGGCAGCTCGGTGAAGTTTTCACTCCACAGGCTGCGCA CCATCACCAACGCGTTTAGCAGGTCGGGCGCCGATATCTTGAAGTCGCAGTTGGGGCCTCCGCCCTGCGCGCGCGAGTTG CGATACACAGGGTTGCAGCACTGGAACACTATCAGCGCCGGGTGGTGCACGCTGGCCAGCACGCTCTTGTCGGAGATCAG ATCCGCGTCCAGGTCCTCCGCGTTGCTCAGGGCGAACGGAGTCAACTTTGGTAGCTGCCTTCCCAAAAAGGGTGCATGCC CAGGCTTTGAGTTGCACTCGCACCGTAGTGGCATCAGAAGGTGACCGTGCCCGGTCTGGGCGTTAGGATACAGCGCCTGC ATGAAAGCCTTGATCTGCTTAAAAGCCACCTGAGCCTTTGCGCCTTCAGAGAAGAACATGCCGCAAGACTTGCCGGAAAA CTGATTGGCCGGACAGGCCGCGTCATGCACGCAGCACCTTGCGTCGGTGTTGGAGATCTGCACCACATTTCGGCCCCACC GGTTCTTCACGATCTTGGCCTTGCTAGACTGCTCCTTCAGCGCGCGCTGCCCGTTTTCGCTCGTCACATCCATTTCAATC ACGTGCTCCTTATTTATCATAATGCTCCCGTGTAGACACTTAAGCTCGCCTTCGATCTCAGCGCAGCGGTGCAGCCACAA CGCGCAGCCCGTGGGCTCGTGGTGCTTGTAGGTTACCTCTGCAAACGACTGCAGGTACGCCTGCAGGAATCGCCCCATCA TCGTCACAAAGGTCTTGTTGCTGGTGAAGGTCAGCTGCAACCCGCGGTGCTCCTCGTTTAGCCAGGTCTTGCATACGGCC GCCAGAGCTTCCACTTGGTCAGGCAGTAGCTTGAAGTTTGCCTTTAGATCGTTATCCACGTGGTACTTGTCCATCAACGC GCGCGCAGCCTCCATGCCCTTCTCCCACGCAGACACGATCGGCAGGCTCAGCGGGTTTATCACCGTGCTTTCACTTTCCG CTTCACTGGACTCTTCCTTTTCCTCTTGCGTCCGCATACCCCGCGCCACTGGGTCGTCTTCATTCAGCCGCCGCACCGTG CGCTTACCTCCCTTGCCGTGCTTGATTAGCACCGGTGGGTTGCTGAAACCCACCATTTGTAGCGCCACATCTTCTCTTTC TTCCTCGCTGTCCACGATCACCTCTGGGGATGGCGGGCGCTCGGGCTTGGGAGAGGGGCGCTTCTTTTTCTTTTTGGACG CAATGGCCAAATCCGCCGTCGAGGTCGATGGCCGCGGGCTGGGTGTGCGCGGCACCAGCGCATCTTGTGACGAGTCTTCT TCGTCCTCGGACTCGAGACGCCGCCTCAGCCGCTTTTTTGGGGGCGCGCGGGGAGGCGGCGGCGACGGCGACGGGGACGA CACGTCCTCCATGGTTGGTGGACGTCGCGCCGCACCGCGTCCGCGCTCGGGGGTGGTTTCGCGCTGCTCCTCTTCCCGAC TGGCCATTTCCTTCTCCTATAGGCAGAAAAAGATCATGGAGTCAGTCGAGAAGGAGGACAGCCTAACCGCCCCCTTTGAG TTCGCCACCACCGCCTCCACCGATGCCGCCAACGCGCCTACCACCTTCCCCGTCGAGGCACCCCCGCTTGAGGAGGAGGA AGTGATTATCGAGCAGGACCCAGGTTTTGTAAGCGAAGACGACGAGGATCGCTCAGTACCAACAGAGGATAAAAAGCAAG ACCAGGACGACGCAGAGGCAAACGAGGAACAAGTCGGGCGGGGGGACCAAAGGCATGGCGACTACCTAGATGTGGGAGAC GACGTGCTGTTGAAGCATCTGCAGCGCCAGTGCGCCATTATCTGCGACGCGTTGCAAGAGCGCAGCGATGTGCCCCTCGC CATAGCGGATGTCAGCCTTGCCTACGAACGCCACCTGTTCTCACCGCGCGTACCCCCCAAACGCCAAGAAAACGGCACAT GCGAGCCCAACCCGCGCCTCAACTTCTACCCCGTATTTGCCGTGCCAGAGGTGCTTGCCACCTATCACATCTTTTTCCAA AACTGCAAGATACCCCTATCCTGCCGTGCCAACCGCAGCCGAGCGGACAAGCAGCTGGCCTTGCGGCAGGGCGCTGTCAT ACCTGATATCGCCTCGCTCGACGAAGTGCCAAAAATCTTTGAGGGTCTTGGACGCGACGAGAAACGCGCGGCAAACGCTC TGCAACAAGAAAACAGCGAAAATGAAAGTCACTGTGGAGTGCTGGTGGAACTTGAGGGTGACAACGCGCGCCTAGCCGTG CTGAAACGCAGCATCGAGGTCACCCACTTTGCCTACCCGGCACTTAACCTACCCCCCAAGGTTATGAGCACAGTCATGAG CGAGCTGATCGTGCGCCGTGCACGACCCCTGGAGAGGGATGCAAACTTGCAAGAACAAACCGAGGAGGGCCTACCCGCAG TTGGCGATGAGCAGCTGGCGCGCTGGCTTGAGACGCGCGAGCCTGCCGACTTGGAGGAGCGACGCAAGCTAATGATGGCC GCAGTGCTTGTTACCGTGGAGCTTGAGTGCATGCAGCGGTTCTTTGCTGACCCGGAGATGCAGCGCAAGCTAGAGGAAAC GTTGCACTACACCTTTCGCCAGGGCTACGTGCGCCAGGCCTGCAAAATTTCCAACGTGGAGCTCTGCAACCTGGTCTCCT ACCTTGGAATTTTGCACGAAAACCGCCTCGGGCAAAACGTGCTTCATTCCACGCTCAAGGGCGAGGCGCGCCGCGACTAC GTCCGCGACTGCGTTTACTTATTTCTGTGCTACACCTGGCAAACGGCCATGGGCGTGTGGCAGCAATGCCTGGAGGAGCG CAACCTAAAGGAGCTGCAGAAGCTGCTAAAGCAAAACTTGAAGGACCTATGGACGGCCTTCAACGAGCGCTCCGTGGCCG CGCACCTGGCGGACATTATCTTCCCCGAACGCCTGCTTAAAACCCTGCAACAGGGTCTGCCAGACTTCACCAGTCAAAGC ATGTTGCAAAACTTTAGGAACTTTATCCTAGAGCGTTCAGGAATTCTGCCCGCCACCTGCTGTGCGCTTCCTAGCGACTT TGTGCCCATTAAGTACCGTGAATGCCCTCCGCCGCTTTGGGGTCACTGCTACCTTCTGCAGCTAGCCAACTACCTTGCCT ACCACTCCGACATCATGGAAGACGTGAGCGGTGACGGCCTACTGGAGTGTCACTGTCGCTGCAACCTATGCACCCCGCAC CGCTCCCTGGTCTGCAATTCGCAACTGCTTAGCGAAAGTCAAATTATCGGTACCTTTGAGCTGCAGGGTCCCTCGCCTGA CGAAAAGTCCGCGGCTCCGGGGTTGAAACTCACTCCGGGGCTGTGGACGTCGGCTTACCTTCGCAAATTTGTACCTGAGG ACTACCACGCCCACGAGATTAGGTTCTACGAAGACCAATCCCGCCCGCCAAATGCGGAGCTTACCGCCTGCGTCATTACC CAGGGCCACATCCTTGGCCAATTGCAAGCCATCAACAAAGCCCGCCAAGAGTTTCTGCTACGAAAGGGACGGGGGGTTTA CCTGGACCCCCAGTCCGGCGAGGAGCTCAACCCAATCCCCCCGCCGCCGCAGCCCTATCAGCAGCCGCGGGCCCTTGCTT CCCAGGATGGCACCCAAAAAGAAGCTGCAGCTGCCGCCGCCGCCACCCACGGACGAGGAGGAATACTGGGACAGTCAGGC AGAGGAGGTTTTGGACGAGGAGGAGGAGATGATGGAAGACTGGGACAGCCTAGACGAAGCTTCCGAGGCCGAAGAGGTGT CAGACGAAACACCGTCACCCTCGGTCGCATTCCCCTCGCCGGCGCCCCAGAAATTGGCAACCGTTCCCAGCATCGCTACA ACCTCCGCTCCTCAGGCGCCGCCGGCACTGCCTGTTCGCCGACCCAACCGTAGATGGGACACCACTGGAACCAGGGCCGG TAAGTCTAAGCAGCCGCCGCCGTTAGCCCAAGAGCAACAACAGCGCCAAGGCTACCGCTCGTGGCGCGGGCACAAGAACG CCATAGTTGCTTGCTTGCAAGACTGTGGGGGCAACATCTCCTTCGCCCGCCGCTTTCTTCTCTACCATCACGGCGTGGCC TTCCCCCGTAACATCCTGCATTACTACCGTCATCTCTACAGCCCCTACTGCACCGGCGGCAGCGGCAGCGGCAGCAACAG CAGCGGTCACACAGAAGCAAAGGCGACCGGATAGCAAGACTCTGACAAAGCCCAAGAAATCCACAGCGGCGGCAGCAGCA GGAGGAGGAGCGCTGCGTCTGGCGCCCAACGAACCCGTATCGACCCGCGAGCTTAGAAATAGGATTTTTCCCACTCTGTA TGCTATATTTCAACAAAGCAGGGGCCAAGAACAAGAGCTGAAAATAAAAAACAGGTCTCTGCGCTCCCTCACCCGCAGCT GCCTGTATCACAAAAGCGAAGATCAGCTTCGGCGCACGCTGGAAGACGCGGAGGCTCTCTTCAGCAAATACTGCGCGCTG ACTCTTAAGGACTAGTTTCGCGCCCTTTCTCAAATTTAAGCGCGAAAACTACGTCATCTCCAGCGGCCACACCCGGCGCC AGCACCTGTCGTCAGCGCCATTATGAGCAAGGAAATTCCCACGCCCTACATGTGGAGTTACCAGCCACAAATGGGACTTG CGGCTGGAGCTGCCCAAGACTACTCAACCCGAATAAACTACATGAGCGCGGGACCCCACATGATATCCCGGGTCAACGGA ATCCGCGCCCACCGAAACCGAATTCTCCTCGAACAGGCGGCTATTACCACCACACCTCGTAATAACCTTAATCCCCGTAG TTGGCCCGCTGCCCTGGTGTACCAGGAAAGTCCCGCTCCCACCACTGTGGTACTTCCCAGAGACGCCCAGGCCGAAGTTC AGATGACTAACTCAGGGGCGCAGCTTGCGGGCGGCTTTCGTCACAGGGTGCGGTCG
AdV_E4 CCCGGGCGTTTTAGGGCGGAGTAACTTGCATGTATTGGGAATTGTAGTTTTTTTAAAATGGGAAGTGACGTATCGTGGGA AAACGGAAGTGAAGATTTGAGGAAGTTGTGGGTTTTTTGGCTTTCGTTTCTGGGCGTAGGTTCGCGTGCGGTTTTCTGGG TGTTTTTTGTGGACTTTAACCGTTACGTCATTTTTTAGTCCTATATATACTCGCTCTGTACTTGGCCCTTTTTACACTGT GACTGATTGAGCTGGTGCCGTGTCGAGTGGTGTTTTTTAATAGGTTTTTTTACTGGTAAGGCTGACTGTTATGGCTGCCG CTGTGGAAGCGCTGTATGTTGTTCTGGAGCGGGAGGGTGCTATTTTGCCTAGGCAGGAGGGTTTTTCAGGTGTTTATGTG TTTTTCTCTCCTATTAATTTTGTTATACCTCCTATGGGGGCTGTAATGTTGTCTCTACGCCTGCGGGTATGTATTCCCCC GGGCTATTTCGGTCGCTTTTTAGCACTGACCGATGTTAACCAACCTGATGTGTTTACCGAGTCTTACATTATGACTCCGG ACATGACCGAGGAACTGTCGGTGGTGCTTTTTAATCACGGTGACCAGTTTTTTTACGGTCACGCCGGCATGGCCGTAGTC CGTCTTATGCTTATAAGGGTTGTTTTTCCTGTTGTAAGACAGGCTTCTAATGTTTAAATGTTTTTTTTTTTGTTATTTTA TTTTGTGTTTAATGCAGGAACCCGCAGACATGTTTGAGAGAAAAATGGTGTCTTTTTCTGTGGTGGTTCCGGAACTTACC TGCCTTTATCTGCATGAGCATGACTACGATGTGCTTGCTTTTTTGCGCGAGGCTTTGCCTGATTTTTTGAGCAGCACCTT GCATTTTATATCGCCGCCCATGCAACAAGCTTACATAGGGGCTACGCTGGTTAGCATAGCTCCGAGTATGCGTGTCATAA TCAGTGTGGGTTCTTTTGTCATGGTTCCTGGCGGGGAAGTGGCCGCGCTGGTCCGTGCAGACCTGCACGATTATGTTCAG CTGGCCCTGCGAAGGGACCTACGGGATCGCGGTATTTTTGTTAATGTTCCGCTTTTGAATCTTATACAGGTCTGTGAGGA ACCTGAATTTTTGCAATCATGATTCGCTGCTTGAGGCTGAAGGTGGAGGGCGCTCTGGAGCAGATTTTTACAATGGCCGG ACTTAATATTCGGGATTTGCTTAGAGACATATTGATAAGGTGGCGAGATGAAAATTATTTGGGCATGGTTGAAGGTGCTG GAATGTTTATAGAGGAGATTCACCCTGAAGGGTTTAGCCTTTACGTCCACTTGGACGTGAGGGCAGTTTGCCTTTTGGAA GCCATTGTGCAACATCTTACAAATGCCATTATCTGTTCTTTGGCTGTAGAGTTTGACCACGCCACCGGAGGGGAGCGCGT TCACTTAATAGATCTTCATTTTGAGGTTTTGGATAATCTTTTGGAATAAAAAAAAAAAAACATGGTTCTTCCAGCTCTTC CCGCTCCTCCCGTGTGTGACTCGCAGAACGAATGTGTAGGTTGGCTGGGTGTGGCTTATTCTGCGGTGGTGGATGTTATC AGGGCAGCGGCGCATGAAGGAGTTTACATAGAACCCGAAGCCAGGGGGCGCCTGGATGCTTTGAGAGAGTGGATATACTA CAACTACTACACAGAGCGAGCTAAGCGACGAGACCGGAGACGCAGATCTGTTTGTCACGCCCGCACCTGGTTTTGCTTCA GGAAATATGACTACGTCCGGCGTTCCATTTGGCATGACACTACGACCAACACGATCTCGGTTGTCTCGGCGCACTCCGTA CAGTAGGGATCGCCTACCTCCTTTTGAGACAGAGACCCGCGCTACCATACTGGAGGATCATCCGCTGCTGCCCGAATGTA ACACTTTGACAATGCACAACGTGAGTTACGTGCGAGGTCTTCCCTGCAGTGTGGGATTTACGCTGATTCAGGAATGGGTT GTTCCCTGGGATATGGTTCTGACGCGGGAGGAGCTTGTAATCCTGAGGAAGTGTATGCACGTGTGCCTGTGTTGTGCCAA CATTGATATCATGACGAGCATGATGATCCATGGTTACGAGTCCTGGGCTCTCCACTGTCATTGTTCCAGTCCCGGTTCCC TGCAGTGCATAGCCGGCGGGCAGGTTTTGGCCAGCTGGTTTAGGATGGTGGTGGATGGCGCCATGTTTAATCAGAGGTTT ATATGGTACCGGGAGGTGGTGAATTACAACATGCCAAAAGAGGTAATGTTTATGTCCAGCGTGTTTATGAGGGGTCGCCA CTTAATCTACCTGCGCTTGTGGTATGATGGCCACGTGGGTTCTGTGGTCCCCGCCATGAGCTTTGGATACAGCGCCTTGC ACTGTGGGATTTTGAACAATATTGTGGTGCTGTGCTGCAGTTACTGTGCTGATTTAAGTGAGATCAGGGTGCGCTGCTGT GCCCGGAGGACAAGGCGTCTCATGCTGCGGGCGGTGCGAATCATCGCTGAGGAGACCACTGCCATGTTGTATTCCTGCAG GACGGAGCGGCGGCGGCAGCAGTTTATTCGCGCGCTGCTGCAGCACCACCGCCCTATCCTGATGCACGATTATGACTCTA CCCCCATGTAGGCGTGGACTTCCCCTTCGCCGCCCGTTGAGCAACCGCAAGTTGGACAGCAGCCTGTGGCTCAGCAGCTG GACAGCGACATGAACTTAAGCGAGCTGCCCGGGGAGTTTATTAATATCACTGATGAGCGTTTGGCTCGACAGGAAACCGT GTGGAATATAACACCTAAGAATATGTCTGTTACCCATGATATGATGCTTTTTAAGGCCAGCCGGGGAGAAAGGACTGTGT ACTCTGTGTGTTGGGAGGGAGGTGGCAGGTTGAATACTAGGGTTCTGTGAGTTTGATTAAGGTACGGTGATCAATATAAG CTATGTGGTGGTGGGGCTATACTACTGAATGAAAAATGACTTGAAATTTTCTGCAATTGAAAAATAAACACGTTGAAACA TAACATGCAACAGGTTCACGATTCTTTATTCCTGGGCAATGTAGGAGAAGGTGTAAGAGTTGGTAGCAAAAGTTTCAGTG GTGTATTTTCCACTTTCCCAGGACCATGTAAAAGACATAGAGTAAGTGCTTACCTCGCTAGTTTCTGTGGATTCACTAGA A
AdV_VA TCGATGTAGGATGTTGCCCCTCCTGACGCGGTAGGAGAAGGGGAGGGTGCCCTGCATGTCTGCCGCTGCTCTTGCTCTTG CCGCTGCTGAGGAGGGGGGCGCATCTGCCGCAGCACCGGATGCATCTGGGAAAAGCAAAAAAGGGGCTCGTCCCTGTTTC CGGAGGAATTTGCAAGCGGGGTCTTGCATGACGGGGAGGCAAACCCCCGTTCGCCGCAGTCCGGCCGGCCCGAGACTCGA ACCGGGGGTCCTGCGACTCAACCCTTGGAAAATAACCCTCCGGCTACAGGGAGCGAGCCACTTAATGCTTTCGCTTTCCA GCCTAACCGCTTACGCCGCGCGCGGCCAGTGGCCAAAAAAGCTAGCGCAGCAGCCGCCGCGCCTGGAAGGAAGCCAAAAG GAGCGCTCCCCCGTTGTCTGACGTCGCACACCTGGGTTCGACACGCGGGCGGTAACCGCATGGATCACGGCGGACGGCCG GATCCGGGGTTCGAACCCCGGTCGTCCGCCATGATACCCTTGCGAATTTATCCACCAGACCACGGAAGAGTGCCCGCTTA CAGGCTCTCCTTTTGCACGGTCTAGAGCGTCAACGACTGCGCACGCCTCACCGGCCAGAGCGTCCCGACCATGGAGCACT TTTTGCCGCTGCGCAACATCTGGAACCGCGTCCGCGACTTTCCGCGCGCCTCCACCACCGCCGCCGGCATCACCTGGATG TCCAGGTACATCTACGGATTACG
LITR CATCATCAATAATATACCTTATTTTGGATTGAAGCCAATATGATAATGAGGGGGTGGAGTTTGTGACGTGGCGCGGGGCG TGGGAACGGGGCGGGTGACGTAG
RITR CTACGTCACCCGCCCCGTTCCCACGCCCCGCGCCACGTCACAAACTCCACCCCCTCATTATCATATTGGCTTCAATCCAA AATAAGGTATATTATTGATGATG
Encap GTGCGCCGGTGTACACAGGAAGTGACAATTTTCGCGCGGTTTTAGGCGGATGTTGTAGTAAATTTGGGCGTAACCGAGTA AGATTTGGCCATTTTCGCGGGAAAACTGAATAAGAGGAAGTGAAATCTGAATAATTTTGTGTTACTCAT
RBS_Kozak GAAGGAGAGGCCACCATG
thromb_targ CTTGTTCCGCGTGGTTTC
thromb_targ CTGGTTCCGCGTGGTTCT
kemptide_targ CTTAGACGCGCATCACTTGGTAGATCC
SV40_3_splice CCAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCTAATTGTTTGTGTATTTTAGAT
3xSp1 TGCCCCGCCCCTAGCGATTAGCCCCGGCCCCGCATAGCTCCGCCCCGG
RXR_rec CGGCCGCCTAAGTCATTTGGTGCGGCGCCTCCAGCATCTCCATAAGGAAGGTGTCAATGGGTGTGTCCCCGATGAGCTTG AAGAAGAAGAGATGTTCCAGGCATTTGAGCCCGATGGAGCGCAGAGCCGGCAGGCGGAGCAAGAGCTTAGCGAACCTTCC CGGCTGCTCTGGGTACTTGTGCTTGCAGTAGGCCTCCAAGGACGCATAGACCTTCTCCCTCAGCGCCTCCACCTCGGCCG GGTTCGAGAGCCCCTTGGAGTCAGGGTTAAAGAGGACGATGGCGCGCAGGCAGCCCAGCTCCGTCTTGTCCATCTGCATG TCCCGCATCTTGGACACAAGCTCCGTCAGCACCCTGTCAAAGATGGCGCCCACCCCTGCGCTGTGGGCGCTGTTCCGGTG GACGTGCAGCCCGGTGGCCAGGAGGATCCCGTCCTTCACGGCGATGGAGCGGTGGGAGAAGGAGGCGATGAGCAGCTCAT TCCAGCCTGCCCGCAGCAGGATGACCTGGTCGTCCAGGGGCAGCTCTGAGAAGTGTGGGATCCGCTTGGCCCACTCCACC AGGGTGAAAAGCTGTTTGTCGGCTGCTTGGCAAATGTTGGTGACAGGGTCGTTCGGCGAGCTGGGGTTCAGCCCCATGTT TGCCTCCACGTAGGTCTCGGTCTTGGGCTCCACGGCCAGCTCAGCCTCCAGGATCCTCTCCACCGGCATGTCCTCGTTGG CGCTGCTGGTCGACTCCACCTCATTCTCGTTCCGGTCCTTGCCACGCTGCCGCTCCTCCTGCACGGCTTCCCGCTTCATG CCCATGGCCAGGCACTTCTGGTAGCGGCAGTACTGGCACCGGTTCCGCTGCCGCTTGTCAATCAGGCAGTCCTTGTTGTC GCGGCAGGTGTAGGTCAGGTCCTTGCGCACCGTCCGCTTGAAGAAGCCCTTGCACCCCTCGCAGCTGTACACTCCATAGT GCTTGCCTGAGGAGCGGTCCCCGCAGATGGCGCAGATGTGCTTGGTGAAGGAAGCCATGTTTCCTGAGGGGTGGGCGGGG ACCTTGAGGACGCCATTGAGGCCCAGGGGGGGCTTGATGTCCTCGCTGCTGCTGACGGGGTTCATAGGTGAGCTGAGCTG GGGGCTGCCAGTGCTGAAGCCCAGGGTGGGTGTGGTGGGCACCGACATGGAGTGGGGGCCCATGGGGGAGCTGATGACCG AGAAAGGCGGGCCCATGCCGTTGATGGGGGAGCTCAGGGTGCTGATGGGAGAATGCAGCTGTCCCGGGGAGCCGATGCCA GGCCCCAGGGACGGGTGCAGCGAGGGGGCAGCCATGGAGCCTCGCCCCGTCGGGGAGGTGAGGGAGGAGTTCACCTGGGT GGAGAAATCGAGCGGCAGGAAATGTTTGGTGTCCAAGTCTTCTTCAGAAATAAGTTTTTGTTCCATATTATC
VgEcR_rec GTAACCCTATGCAGTCGTCGAGTGCTCCGACTTAACCGCCACTCCCCCGATAAGCTGCTCTTGGTGCGAATGCAGGGCTA CACCCATCAAGGCCATCGCCGTCTGGGCGTTCGCATACATGCTGACGTTGCCGCCCACCCCAACACCGACTCCAACTCCG TTGCCCATCGGTACCGCTGATGTGGTGGAGCTAGCGGTAACGGCAGCCGTGATACTGCTGGTGGTTGCCGGCGTGATGGG TCCTATGGCCGCACTTCCGCCCATGTATTCGCTGCTCGTACTGACCGCGGACAAGGAACCAGGTGCGGTTACGGAGGCGG GCACGGGAGCGGAGACGGGAAGGAGCTGTGGCTGTGGTTGAATCTGTGGCTGGAGTTGCGTCTGAAGCTGTGGGTGGAGC TGGGGTTGCAGTTGACCTTGCAGCTGAGGTGGTAGCTGAGGTTGTAGCTGCGGCTGTGTCTGGTGCTGGGAATCGTTCTG GGTCAGGGAGGAGGGTTGGGGCTGGGGCTGAGGCTGAGGCTGATGCTGGGCCGCGGCTGCCGCCGCCGAAGTGGAGGCAG AGTCGCAATCAATGCCGGCGGTAATGGCGCCCCCAACCGATGCCCGCATACGCTCAGCCCGCTCGAGACGCTCGTTCTCC TCCTGGGTAATCTGAAGGTGCGACTGGACCGATGGCGGGATGGCATGAACGTCCCAGATCTCCTCGAGGAACTTGGGCAG TTTGCGGTTTTTGAGCTTTAGTGAGAAACACATCTCGGCGTTCTGGTTGCCCAGCGTACGCAGCTCGGTGAGGATCGAGA GCAGCTTTGCGTAGAAGACGAGGCTCATTGAGTCGCCGCAGTGGCGGTTGAGTATATAAATGCGTAGCGTGTCGATGTAG TAGCTCTGGATCGCTTCGACTAGCTGGGCCTTCTCCAGGCCCGGCCGGTCCGAGAAGATCACAATGGCAGTGAGAAGCGC GTATTCGACGTTGTCCACCTTCATCGAGAACATTTGGCGGCAGAAATGCAGCAGGTCTTCAATGTTATCAGCCATTCCGG CCATTTTGTAAGAATCCCGCGTATATGATCTATTATTCGCGAAGAATATTGAGTCCGAGCTGTGGTCATAGCGTCGTGCC ATACGCAGCATCATCACCTCCGACGAGCAGGCCTTTAGTAACGTGATCTGGTCCTCCTGGGGTATCTTTGTAAACGCTGG TAGACCTTTAGCAAACTCAACAATCAACTGGACCGTGAGTATGGTTATCTCGGTTATATGCCGAAAGCTGACGTCCGTTT GGCTCTCGTTCTCATCGGGTTGACTCATTATACGCCTGAGATCCTCTTCAGATGGCTGCTCATAGCCATCCTGGTACCAA ATTAACTTGTATATAACGGCCAACTGATTGTACGTTAAGGAAGGTATATTGCGCGCTTGACACTTGGCCAATATTTCATC AGGTAGTAGCGGAATAGTGGCATGCTGGGGCGGCTCGCATGTCATAAGGTCAAGAATCTCCTTCTTAACAAAGTCTTGGC CGCCACCAGAGGCCAAGCTGCCATTGCCGCCATGCTGAGAGCTCGGCGAAGTGGTCATTTTGTCCTTCTCCTTCTGGGCC TTCTTTTCGCGCCGCTTCATCGCACATTGGTTCTCCGGGACGACGCATTCCGGCCGCATACCCACGGCCAGGCACTTTTT CAGGCGGCACTCCTGACACTTTCGCCTCATGTACATGTCCATTTCGCAGGCGCGCCCGAACTTGCAGCAGTAGACGGCGC TCTTCGTAACGCTGCGTCGAAAGAACACCTTGCAGGATCCACAGGTGAGGGCGTTGTAGTGGTAGCCGGAGGCCCTGTCG CCGCAAACCAGGCACAGCTCCTCTTGCACCCGTGGCGCAGGTCCCTTCTTGCTCTTCTTCACATCGCAGCTTTCGTTCGC CGAGTATCCGTTCAAGCTGCTCGAAGGCGAGAGATCATCGCGACCTGAAGATATAGAATTTGATATTCTTCTAGATGTAC CTAGAAGCTTCCCACCGTACTCGTCAATTCCAAGGGCATCGGTAAACATCTGCTCAAACTCGAAGTCGGCCATATCCAGA GCGCCGTAGGGGGCGGAGTCGTGGGGGGTAAATCCCGGACCTGGGGAATCCCCGTCCCCCAACATGTCCAGATCGAAATC GTCTAGCGCGTCGGCATGCGCCATCGCCACGTCCTCGCCGTCTAAGTGGAGTTCGTCCCCCAGGCTGACATCGGTCGGGG GGGCCAAGTCTTCTTCAGAAATAAGTTTTTGTTCCATGGTGGCG
EK GATGACGACGACAAG
EK GATGACGATGACAAG
T7_gene10_leader ATGGCTAGCATGACTGGTGGACAGCAAATGGGT
5_LTR AACGCCATTTTGCAAGGCATGGAAAAATACATAACGCATGCCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAA TGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAG GGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCA AGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCC TACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGAT AGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGG GACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAG CAGAGATGCATCCTCACTCGGGGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCT TGCAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTC TTTCATT
5_LTR2 AACGCCATTTTGCAAGGCATGGAAAAATACATAACTGAGAATAGAAAAGTTCAGATCAAGGTCAGGAACAGATGGAACAG CTGAATATGGGCCAAAGCGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGAACAGCTGAA TATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCGGTC CAGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTG AACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCCTC ACTCGGGGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGA CTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTCTTTCATT
psi_plus_pack2 TTGGGGGCTCGTCCGGGATCGGGAGACCCCTGCCCAGGGACCACCGACCCACCACCGGGAGGTAAGCTGGCCAGCAACTT ATCTGTGTCTGTCCGATTGTCTAGTGTCTATGACTGATTTTATGCGCCTGCGTCGGTACTAGTTAGCTAACTAGCTCTGT ATCTGGCGGACCCGTGGTGGAACTGACGAGTTCGGAACACCCGGCCGCAACCCTGGGAGACGTCCCAGGGACTTCGGGGG CCGTTTTTGTGGCCCGACCTGAGTCCAAAAATCCCGATCGTTTTGGACTCTTTGGTGCACCCCCCTTAGAGGAGGGATAT GTGGTTCTGGTAGGAGACGAGAACCTAAAACAGTTCCCGCCTCCGTCTGAATTTTTGCTTTCGGTTTGGGACCGAAGCCG CGCCGCGCGTCTTGTCTGCTGCAGCATCGTTCTGTGTTGTCTCTGTCTGACTGTGTTTCTGTATTTGTCTGAAAATATGG GCCCGGGCCAGACTGTTACCACTCCCTTAAGTTTGACCTTAGGTCACTGGAAAGATGTCGAGCGGATCGCTCACAACCAG TCGGTAGATGTCAAGAAGAGACGTTGGGTTACCTTCTGCTCTGCAGAATGGCCAACCTTTAACGTCGGATGGCCGCGAGA CGGCACCTTTAACCGAGACCTCATCACCCAGGTTAAGATCAAGGTCTTTTCACCTGGCCCGCATGGACACCCAGACCAGG TCCCCTACATCGTGACCTGGGAAGCCTTGGCTTTTGACCCCCCTCCCTGGGTCAAGCCCTTTGTACACCCTAAGCCTCCG CCTCCTCTTCCTCCATCCGCCCCGTCTCTCCCCCTTGAACCTCCTCGTTCGACCCCGCCTCGATCCTCCCTTTATCCAGC CCTCACTCCTTCTCTAGGCGCCCCCATATGGCCATATGAGATCTTATATGGGGCACCCCCGCCCCTTGTAAACTTCCCTG ACCCTGACATGACAAGAGTTACTAACAGCCCCTCTCTCCAAGCTCACTTACAGGCTCTCTACTTAGTCCAGCACGAAGTC TGGAGACCTCTGGCGGCACGTACCAAGAACAACTGGACCGACCGGTGGTACCTCACCCTTACCGAGTCGGCGACACAGTG TGGGTCCGCCGACACCAGACTAAGAACCTAGAACCTCGCTGGAAAGGACCTTACACAGTCCTGCTGACCACCCCCACCGC CCTCAAAGTAGACGGCATCGCAGCTTGGATACACGCCGCCCACGTGAAGGCTGCCGACCCCGGGGGTGGACCATCCTCTA GACTGCC
gag ATGGGCCCGGGCCAGACTGTTACCACTCCCTTAAGTTTGACCTTAGGTCACTGGAAAGATGTCGAGCGGATCGCTCACAA CCAGTCGGTAGATGTCAAGAAGAGACGTTGGGTTACCTTCTGCTCTGCAGAATGGCCAACCTTTAACGTCGGATGGCCGC GAGACGGCACCTTTAACCGAGACCTCATCACCCAGGTTAAGATCAAGGTCTTTTCACCTGGCCCGCATGGACACCCAGAC CAGGTCCCCTACATCGTGACCTGGGAAGCCTTGGCTTTTGACCCCCCTCCCTGGGTCAAGCCCTTTGTACACCCTAAGCC TCCGCCTCCTCTTCCTCCATCCGCCCCGTCTCTCCCCCTTGAACCTCCTCGTTCGACCCCGCCTCGATCCTCCCTTTATC CAGCCCTCACTCCTTCTCTAGGCGCCCCCATATGGCCATATGAGATCTTATATGGGGCACCCCCGCCCCTTGTAAACTTC CCTGACCCTGACATG
SIN TGATCATCCGGATGCATACGTAGGGACCCGGCGCGCCACGCGTC
myr ATGGGGAGTAGCAAGAGCAAGCCTAAGGACCCCAGCCAGCGCCGG
RPA ATGCAGGGTTCTGTGACAGAGTTTCTAAAACCGCGCCTGGTTGATATCGAGCAAGTGAGTTCGACGCACGCCAAGGTGAC CCTTGAGCCTTTAGAGCGTGGCTTTGGCCATACTCTGGGTAACGCACTGCGCCGTATTCTGCTCTCATCGATGCCGGGTT GCGCGGTGACCGAGGTTGAGATTGATGGTGTACTACATGAGTACAGCACCAAAGAAGGCGTTCAGGAAGATATCCTGGAA ATCCTGCTCAACCTGAAAGGGCTGGCGGTGAGAGTTCAGGGCAAAGATGAAGTTATTCTTACCTTGAATAAATCTGGCAT TGGCCCTGTGACTGCAGCCGATATCACCCACGACGGTGATGTCGAAATCGTCAAGCCGCAGCACGTGATCTGCCACCTGA CCGATGAGAACGCGTCTATTAGCATGCGTATCAAAGTTCAGCGCGGTCGTGGTTATGTGCCGGCTTCTACCCGAGTTCAT TCGGAAGAAGATGAGCGCCCAATCGGCCGTCTGCTGGTCGACGCATGCTACAGCCCTGTGGAGCGTATTGCCTACAATGT TGAAGCAGCGCGTGTAGAACAGCGTACCGACCTGGACAAGCTGGTCATCGAAATGGAAACCAACGGCACAATCGATCCTG AAGAGGCGATTCGTCGTGCGGCAACCATTCTGGCTGAACAACTGGAAGCTTTCGTTGACTTACGTGATGTACGTCAGCCT GAAGTGAAAGAAGAGAAACCAGAGGCGGCC
SV40_lrgT GGAACTGATGAATGGGAGCAGTGGTGGAATGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGCCATCTAGTGA TGATGAGGCTACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCAAGGACTTTCCTT CAGAATTGCTAAGTTTTTTGAGTCATGCTGTGTTTAGTAATAGAACTCTTGCTTGCTTTGCTATTTACACCACAAAGGAA AAAGCTGCACTGCTATACAAGAAAATTATGGAAAAATATTCTGTAACCTTTATAAGTAGGCATAACAGTTATAATCATAA CATACTGTTTTTTCTTACTCCACACAGGCATAGAGTGTCTGCTATTAATAACTATGCTCAAAAATTGTGTACCTTTAGCT TTTTAATTTGTAAAGGGGTTAATAAGGAATATTTGATGTATAGTGCCTTGACTAGAGATCCATTTTCTGTTATTGAGGAA AGTTTGCCAGGTGGGTTAAAGGAGCATGATTTTAATCCAGAAGAAGCAGAGGAAACTAAACAAGTGTCCTGGAAGCTTGT AACAGAGTATGCAATGGAAACAAAATGTGATGATGTGTTGTTATTGCTTGGGATGTACTTGGAATTTCAGTACAGTTTTG AAATGTGTTTAAAATGTATTAAAAAAGAACAGCCCAGCCACTATAAGTACCATGAAAAGCATTATGCAAATGCTGCTATA TTTGCTGACAGCAAAAACCAAAAAACCATATGCCAACAGGCTGTTGATACTGTTTTAGCTAAAAAGCGGGTTGATAGCCT ACAATTAACTAGAGAACAAATGTTAACAAACAGATTTAATGATCTTTTGGATAGGATGGATATAATGTTTGGTTCTACAG GCTCTGCTGACATAGAAGAATGGATGGCTGGAGTTGCTTGGCTACACTGTTTGTTGCCCAAAATGGATTCAGTGGTGTAT GACTTTTTAAAATGCATGGTGTACAACATTCCTAAAAAAAGATACTGGCTGTTTAAAGGACCAATTGATAGTGGTAAAAC TACATTAGCAGCTGCTTTGCTTGAATTATGTGGGGGGAAAGCTTTAAATGTTAATTTGCCCTTGGACAGGCTGAACTTTG AGCTAGGAGTAGCTATTGACCAGTTTTTAGTAGTTTTTGAGGATGTAAAGGGCACTGGAGGGGAGTCCAGAGATTTGCCT TCAGGTCAGGGAATTAATAACCTGGACAATTTAAGGGATTATTTGGATGGCAGTGTTAAGGTAAACTTAGAAAAGAAACA CCTAAATAAAAGAACTCAAATATTTCCCCCTGGAATAGTCACCATGAATGAGTACAGTGTGCCTAAAACACTGCAGGCCA GATTTGTAAAACAAATAGATTTTAGGCCCAAAGATTATTTAAAGCATTGCCTGGAACGCAGTGAGTTTTTGTTAGAAAAG AGAATAATTCAAAGTGGCATTGCTTTGCTTCTTATGTTAATTTGGTACAGACCTGTGGCTGAGTTTGCTCAAAGTATTCA GAGCAGAATTGTGGAGTGGAAAGAGAGATTGGACAAAGAGTTTAGTTTGTCAGTGTATCAAAAAATGAAGTTTAATGTGG CTATGGGAATTGGAGTTTTAGATTGGCTAAGAAACAGTGATGATGATGATGAAGACAGCCAGGAAAATGCTGATAAAAAT GAAGATGGTGGGGAGAAGAACATGGAAGACTCAGGGCATGAAACAGGCATTGATTCACAGTCCCAAGGCTCATTTCAGGC CCCTCAGTCCTCACAGTCTGTTCATGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTC CCACACCTCCCCCTGAACCTGAAACATAA
VP3 ATGGCGTTGATACCATGGCGGGATCCAGCCCTTCTCGATATATACTTCCCAGGAGTTAATCAGTTTGCTCATGCTCTAAA TGTAGTACATGATTGGGGCCATGGCCTACTTCATTCCGTGGGAAGATATGTGTGGCAAATGGTTGTGCAGGAAACACAAC ACAGACTGGAAGGAGCTGTAAGAGAACTAACTGTAAGACAGACACATACATTCCTGGATGGCCTAGCTAGGCTACTTGAA AACACCCGGTGGGTGGTTTCTAATGCTCCTCAGTCAGCCATAGATGCAATCAACAGAGGTGCCTCATCAGTGAGCTCAGG GTACTCATCACTAAGTGACTATTATAGGCAACTAGGTCTTAATCCACCACAGAGGAGAGCACTCTTTAATCGCATAGAAG GGAGCATGGGAAATGGTGGGCCTACCCCTGCAGCACATATACAGGATGAGTCAGGTGAGGTGATAAAGTTCTATCAGGCC CCAGGTGGTGCCCACCAAAGAGTCACTCCTGACTGGATGCTTCCTTTAATTCTAGGGCTGTACGGTGATATCACACCTAC TTGGGCAACAGTCATAGAGGAAGATGGCCCCCAAAAGAAAAAGTCTAGATAA
r_ORF1629 CGCCCGAAACCAGTACAATAGTTGAGGTGCCGACTGTGTTGCCTGAAAGAGACAATTTGAGCCTAAACCGCCGTCTGCAT CACCGCCACCACCTCCGCCTCCGCCTCCGCCGCCAGCCCCGCCTGCGCCTCCACCGATGGTAGATTTATCATCAGCTCCA CCACCGCCGCCATTAGTAGATTTGCCGTCTGAAATGTTACCACCGCCTGCACCATCGCTTTCTAACGTGTTGTCTGAATT AAAATCGGGCACAGTTAGATTGAAACCCGCCCAAAAACGCCCGCAATCAGAAATAATTCCAAAAAGCTCAACTACAAATT TGATCGCGGACGTGTTAGCCGACACAATTAATAGGCGTCGTGTGGCTATGGCAAAATCGTCTTCGGAAGCAACTTCTAAC GACGAGGGTTGGGACGACGACGATAATCGGCCTAATAAAGCTAACACGCCCGATGTTAAATATGTCCAGGCTTTATTTAA CGTGTTTACGTCGAGTCAATTGTACACTAACGACAGTGATGAAAGAAATACAAAAGCGCATAATATTTTGAACGACGTCG AACCTTTATTACAAAACAAAACACAAACGAATATCGACAAAGCTAGATTGCTGCTACAAGATTTGGCAAGTTTTGTGGCG TTGAGCGAAAATCCATTAGATAGTCCAGCCATCGGTTCGGAAAAACAACCCTTGTTTGAAACTAATCGAAACCTATTTTA CAAATCTATTGAGGATTTAATATTTAAATTCAGATATAAAGACGCTGAAAATCATTTGATTTTCGCTCTAACATACCACC C
attP AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACACATTGATGAGCAATGCTTTTTTATAATGCCAACT TTGTACAAAAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGAC TACATAATACTGTAAAACACAACATATCCAGTCACTATGAATCAACTACTTAGATGGTATTAGTGACCTGTA
attB GTGGCATCTGATAGCTCAACATTTCCGGTCCGGCCTTCTTTGGCGCGGCCACTGCGCAATGCCGTCGGACGGTATCGCAA TATCGTACGGATCTATACCGCAGGCTTCTTCGTCTTCCTGATAACGGTATTCTTGATCCTGCCGACATTTCTCGTCGTCC CGATGAGCCTGAATGACGGCAGCTACCTTGCGTTTCCACCGCAAGGCCTCACTTTAAAATGGTATAGGGCGTATTTCTCT GATCCTGACTGGATGTCGGCAACATTGTTCAGCCTGCAGGTCGCATTCGCGACAGCTATCGTGGCAACAACCATTGGCAC GACAGCAGCGCTAGCGCTCGCAAAGAGTAGATTGCCTTTTAAGGGGCTTCTGCAAAGCCTTGCGCTTGGGCCAATGATCG TCCCGCACGTAGTTCTGGGTGTATCGCTTTACCTGGTGTTCTCACCGTGGAGAGTAACGGGGACGTTTGCAGGCTTTGTT CTCGCGCACACAGTTTTAGCCATCCCCTATGTCATGATCGTGGTGGGTGCTGCGGTGCAGAAGTTTGACCCTTCGCTCGA ACTCGCGGCTCTCAACTGCGGCGCAAATCGATTCCAGAGCTTTTTCCTCGTGATGCTGCCTAATATTGGCCCGAGCGTCG CCGCGGCTTCGGTCTTTGCATTTCTTGCGTCGTTCGATGACGCGACGGTTTCGTTCTTCATCTCTGACATTGGCGGGAAG TCGATTGGACGCAAGATGTTCGAAGATATCGATTTCAATCTCACGCCAGTGATCGCCGCCGCGTCAACCGTGCTCGTCGC GATCTCACTCGTGCTCATGACGGCGGCGCAACTTCTGACTACTCGAAGCAGACACTAA
attB1 ACAAGTTTGTACAAAAAAGCAGGCT
attB2 ACCCAGCTTTCTTGTACAAAGTGGT
ccdB ATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACAC GCCCGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGG TGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTG GCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAA
His_patch_thio ATGGGATCTGATAAAATTATTCATCTGACTGATGATTCTTTTGATACTGATGTACTTAAGGCAGATGGTGCAATCCTGGT TGATTTCTGGGCACACTGGTGCGGTCCGTGCAAAATGATCGCTCCGATTCTGGATGAAATCGCTGACGAATATCAGGGCA AACTGACCGTTGCAAAACTGAACATCGATCACAACCCGGGCACTGCGCCGAAATATGGCATCCGTGGTATCCCGACTCTG CTGCTGTTCAAAAACGGTGAAGTGGCGGCAACCAAAGTGGGTGCACTGTCTAAAGGTCAGTTGAAAGAGTTCCTCGACGC TAACCTGGC
AraC ATGGCTGAAGCGCAAAATGATCCCCTGCTGCCGGGATACTCGTTTAATGCCCATCTGGTGGCGGGTTTAACGCCGATTGA GGCCAACGGTTATCTCGATTTTTTTATCGACCGACCGCTGGGAATGAAAGGTTATATTCTCAATCTCACCATTCGCGGTC AGGGGGTGGTGAAAAATCAGGGACGAGAATTTGTTTGCCGACCGGGTGATATTTTGCTGTTCCCGCCAGGAGAGATTCAT CACTACGGTCGTCATCCGGAGGCTCGCGAATGGTATCACCAGTGGGTTTACTTTCGTCCGCGCGCCTACTGGCATGAATG GCTTAACTGGCCGTCAATATTTGCCAATACGGGGTTCTTTCGCCCGGATGAAGCGCACCAGCCGCATTTCAGCGACCTGT TTGGGCAAATCATTAACGCCGGGCAAGGGGAAGGGCGCTATTCGGAGCTGCTGGCGATAAATCTGCTTGAGCAATTGTTA CTGCGGCGCATGGAAGCGATTAACGAGTCGCTCCATCCACCGATGGATAATCGGGTACGCGAGGCTTGTCAGTACATCAG CGATCACCTGGCAGACAGCAATTTTGATATCGCCAGCGTCGCACAGCATGTTTGCTTGTCGCCGTCGCGTCTGTCACATC TTTTCCGCCAGCAGTTAGGGATTAGCGTCTTAAGCTGGCGCGAGGACCAACGTATCAGCCAGGCGAAGCTGCTTTTGAGC ACCACCCGGATGCCTATCGCCACCGTCGGTCGCAATGTTGGTTTTGACGATCAACTCTATTTCTCGCGGGTATTTAAAAA ATGCACCGGGGCCAGCCCGAGCGAGTTCCGTGCCGGTTGTGAAGAAAAAGTGAATGATGTAGCCGTCAAGTTGTCATAA
3_AcPH GACTCTGCTGAAGAGGAGGAAATTCTCCTTGAAGTTTCCCTGGTGTTCAAAGTAAAGGAGTTTGCACCAGACGCACCTCT GTTCACTGGTCCGGCGTATTAA
trans_en AGCGCAGAGGCTTGGGGCAGCCGAGCGGCAGCCAGGCCCCGGCCCGGGCCTCGGTTCCAGAAGGGAGAGGAGCCCGCCAA GGCGCGCAAGAGAGCGGGCTGCCTCGCAGTCCGAGCCGGAGAGGGAGCGCGAGCCGCGCCGGCCCCGGACGGCCTCCGAA ACC
FRT GAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC
CX_lead ATGACCATGATTACGAATTCCCGGGGATCC
truncRSA GCTGACCCGGCCTTCGGCGGCTTCGAAACCCTCCGCGTCGCTGGCGCGGCGGCTCAAGGCTCGCACAACGCCAACGGCTT CACGGCTCTGCAACTGGGCGCGACGGCGGGTGCGACGACCTTCACCAACGTTGCGGTGAATGTCGGCCTGACCGTTCTGG CGGCTCCGACCGGTACGACGACCGTGACCCTGGCCAACGCCACGGGCACCTCGGACGTGTTCAACCTGACCCTGTCGTCC TCGGCCGCTCTGGCCGCTGGTACGGTTGCGCTGGCTGGCGTCGAGACGGTGAACATCGCCGCCACCGACACCAACACGAC CGCTCACGTCGACACGCTGACGCTGCAAGCCACCTCGGCCAAGTCGATCGTGGTGACGGGCAACGCCGGTCTGAACCTGA CCAACACCGGCAACACGGCTGTCACCAGCTTCGACGCCAGCGCCGTCACCGGCACGGGCTCGGCTGTGACCTTCGTGTCG GCCAACACCACGGTGGGTGAAGTCGTCACGATCCGCGGCGGCGCTGGCGCCGACTCGCTGACCGGTTCGGCCACCGCCAA TGACACCATCATCGGTGGCGCTGGCGCTGACACCCTGGTCTACACCGGCGGTACGGACACCTTCACGGGTGGCACGGGCG CGGATATCTTCGATATCAACGCTATCGGCACCTCGACCGCTTTCGTGACGATCACCGACGCCGCTGTCGGCGACAAGCTC GACCTCGTCGGCATCTCGACGAACGGCGCTATCGCTGACGGCGCCTTCGGCGCTGCGGTCACCCTGGGCGCTGCTGCGAC CCTGGCTCAGTACCTGGACGCTGCTGCTGCCGGCGACGGCAGCGGCACCTCGGTTGCCAAGTGGTTCCAGTTCGGCGGCG ACACCTATGTCGTCGTTGACAGCTCGGCTGGCGCGACCTTCGTCAGCGGCGCTGACGCGGTGATCAAGCTGACCGGTCTG GTCACGCTGACCACCTCGGCCTTCGCCACCGAAGTCCTGACGCTCGCC
attR CTGTGCGCCAGAAGCGGTCATTGGCGCACAAACACTCGCCAAGCCATTATAAAAACCATTCATGGCAGCGATAAAGGCGG CACGGTGGCTTCCGTGGCTTGGAAGGGATATCGTCATTCCGATCACGTCAATCTAGCCTACTCAACGCGCCCGACCTCGT GTAGCGTCGGAATGGGCAGTAAAAGGTTCACCATGTCGCTCCTCGATCCTGACGCAATCCATCCTATCACCCTGCCTGAC GGCAGGGTTTATTCGGACACGGTGTATCTAAAGAACGTCGTCGACCATCCTCGTATCGAGGTCGGCGAATACAGCTACTT CACGCATTCTGGAACCCCAGAAGAGACAGCCCAGATACTTGCCCCTTATCTCGGTCACACATGTCGCGAGCGGCTGCTGA TCGGCAAATTTGTACAGATTGCTAAGGGTTGCTACTTCATAACCAGCTCGGCCAATCATCCCATGACTGGTTTCACAACA TATCCATTTCGAATCTTCAAGCCCGAGACGTTTGGCTACAAGGAACTGCCGGTCAAAGACACGGTCGTCGGTCATGACGT TTGGATCGGCCACAACGCGGCTATCATGCCTGGTGTGCGCATTGGCGCGGGTGCTATCGTGGCCGCAGCCTCGGTCGTTG CTCGCGATATCCCGCCTTACGCCGTGGTTGGCGGCAATCCCGCTACCGTGATTAGAATGCGTTATCCCGCTGAGGTGATA GATGTCCTGCTTCATATTGCTTGGTGGGACTGGCCAATCGAGAAGATTGAAGCTAATTTAGCATCTCTGAGTAATGGTGA CCTTGACGCTCTCAAAATCGCCTAG
attR1 ACAAGTTTGTACAAAAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAA ACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATG
attR2 CATAGTGACTGGATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCTAATTTAATATATTGATATT TATATCATTTTACGTTTCTCG
attL1 AGCCTGCTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGT CAAAATAAAATCATTATTTG
attL2 ACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGT CAAAATAAAATCATTATTTG
T7_transl_en_RBS TTAACTTTAAGAAGGAG
ROP GTGACCAAACAGGAAAAAACCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAA CGAGCTGGACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGCTGCCTCG CGCGTTTCGGTGATGACGGTGAAAACCTCTGA
TEV GAAAACCTGTATTTTCAGGGA
HIV-1_5_LTR GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAG CTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGT CAGTGTGGAAAATCTCTAGCA
HIV-1_psi_pack TGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAG
delta_U3 TGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACT
truncHIV-1_3_LTR GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAG CTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGT CAGTGTGGAAAATCTCTAGCA
ars1 GACAGAATGGGATACAAGGGCATCGTCTATAATTATAGCTAAAAATTGTATTTTAATTTGTATTTTTTGTAATTTTATTT CTCATTGTTTTACTTAAAATGAATGCGAATTAGAGAAAACTTCAACGAAATGTCAAAATAAGCTCAGCAAAATATACAAT TTTAGGGAAAGCGATCAGCAACTTATTCTCCGTTGTAGATTCTTTTTCTTCATAAATTCCAACAACGTAACTGCCAATTG ATTTTTCTCTAGATGCTAATAAATTGGAACTAATGAGTATAATAACACAGGTTTTGATAAATTGTAAACTCTTACTCAAA AAAAGAATGTTAAAACTAATTTAACCTTTTTATAAAGGCTCATGGCGTTAAAGAGGATAGTAAAAATTCTACAATTTTTT AATTTAATGTCGCAATTGTCTTGCGAATATAATTCTATTAATTTTCGCTAACTGCTGTTTTAGTACTATTACTTTCAATA TGCCTTATATGCAACTTTAATTCATGAAGAATGCAATATTTTTGCAATCTTTCTTGTACTGAGCGCTTTTTATCATTTAG TACTCATTATTTAATTTTTCAGTAAAGGGCAATAAATAAATTTGTAGAAGATGCAATGTAATCTCCTCTATCCTTTTGCT CATATATGTTTATGAGTATACCTAGTCTAGAAAGGCTTGTATTTAAAATATTATTCAATAAAAATTCACAATTTTTACGA CATGTGCTACCATTCACCTAACTTCCTGATTATAAAATTGGTTCGTTTATACTAATTACTTAAGTACCTTTAACTAAACA AAATGCCTATATATATATTAATTTACAATGAGTGTCAGATAAGTCACTATGTCCGAGTGGTTAAGGAG
minicis ATGTATCGATTAAATAAGGAGGAATAA
VP22 ATGACCTCTCGCCGCTCCGTGAAGTCGGGTCCGCGGGAGGTTCCGCGCGATGAGTACGAGGATCTGTACTACACCCCGTC TTCAGGTATGGCGAGTCCCGATAGTCCGCCTGACACCTCCCGCCGTGGCGCCCTACAGACACGCTCGCGCCAGAGGGGCG AGGTCCGTTTCGTCCAGTACGACGAGTCGGATTATGCCCTCTACGGGGGCTCGTCTTCCGAAGACGACGAACACCCGGAG GTCCCCCGGACGCGGCGTCCCGTTTCCGGGGCGGTTTTGTCCGGCCCGGGGCCTGCGCGGGCGCCTCCGCCACCCGCTGG GTCCGGAGGGGCCGGACGCACACCCACCACCGCCCCCCGGGCCCCCCGAACCCAGCGGGTGGCGACTAAGGCCCCCGCGG CCCCGGCGGCGGAGACCACCCGCGGCAGGAAATCGGCCCAGCCAGAATCCGCCGCACTCCCAGACGCCCCCGCGTCGACG GCGCCAACCCGATCCAAGACACCCGCGCAGGGGCTGGCCAGAAAGCTGCACTTTAGCACCGCCCCCCCAAACCCCGACGC GCCATGGACCCCCCGGGTGGCCGGCTTTAACAAGCGCGTCTTCTGCGCCGCGGTCGGGCGCCTGGCGGCCATGCATGCCC GGATGGCGGCGGTCCAGCTCTGGGACATGTCGCGTCCGCGCACAGACGAAGACCTCAACGAACTCCTTGGCATCACCACC ATCCGCGTGACGGTCTGCGAGGGCAAAAACCTGCTTCAGCGCGCCAACGAGTTGGTGAATCCAGACGTGGTGCAGGACGT CGACGCGGCCACGGCGACTCGAGGGCGTTCTGCGGCGTCGCGCCCCACCGAGCGACCTCGAGCCCCAGCCCGCTCCGCTT CTCGCCCCAGACGGCCCGTCGAG
CAP_BS TTGCTATGCCATAG
AraI1I2 ATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGA
sh_ble ATGGCCAAGTTGACCAGTGCCGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCTGGACCGACCGGCT CGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCCGGTGTGGTCCGGGACGACGTGACCCTGTTCATCAGCGCGGTCC AGGACCAGGTGGTGCCGGACAACACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACGAGCTGTACGCCGAGTGGTCGGAG GTCGTGTCCACGAACTTCCGGGACGCCTCCGGGCCGGCCATGACCGAGATCGGCGAGCAGCCGTGGGGGCGGGAGTTCGC CCTGCGCGACCCGGCCGGCAACTGCGTGCACTTCGTGGCCGAGGAGCAGGACTGA
alpha ATGAGATTTCCTTCAATTTTTACTGCTGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGA AGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGC CATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTA TCTCTCGAGAAAAGAGAGGCTGAAGCT
3_AOX1 TCGAGTATCTATGATTGGAAGTATGGGAATGGTGATACCCGCATTCTTCAGTGTCTTGAGGTCTCCTATCAGATTATGCC CAACTAAAGCAACCGGAGGAGGAGATTTCATGGTAAATTTCTCTGACTTTTGGTCATCAGTAGACTCGAACTGTGAGACT ATCTCGGTTATGACAGCAGAAATGTCCTTCTTGGAGACAGTAAATGAAGTCCCACCAATAAAGAAATCCTTGTTATCAGG AACAAACTTCTTGTTTCGAACTTTTTCGGTGCCTTGAACTATAAAATGTAGAGTGGATATGTCGGGTAGGAATGGAGCGG GCAAATGCTTACCTTCTGGACCTTCAAGAGGTATGTAGGGTTTGTAGATACTGATGCCAACTTCAGTGACAACGTTGCTA TTTCGTTCAAACCATTCCGAATCCAGAGAAATCAAAGTTGTTTGTCTACTATTGATCCAAGCCAGTGCGGTCTTGAAACT GACAATAGTGTGCTCGTGTTTTGAGGTCATCTTTGTATGAATAAATCTAGTCTTTGATCTAAATAATCTTGACGAGCCAA GGCGATAAATACCCAAATCTAAAACTCTTTTAAAACGTTAAAAGGACAAGTATGTCTGCCTGTATTAAACCCCAAATCAG CTCGTAGTCTGATCCTCATCAACTTGAGGGGCACTATCTTGTTTTAGAGAAATTTGCGGAGATGCGATATCGAGAAAAAG GTACGCTGATTTTAAACGTGAAATTTATCTCAAGATC
PHO1 ATGTTCTCTCCAATTTTGTCCTTGGAAATTATTTTAGCTTTGGCTACTTTGCAATCTGTCTTCGCT
HSA GATGCACACAAGAGTGAGGTTGCTCATCGGTTTAAAGATTTGGGAGAAGAAAATTTCAAAGCCTTGGTGTTGATTGCCTT TGCTCAGTATCTTCAGCAGTGTCCATTTGAAGATCATGTAAAATTAGTGAATGAAGTAACTGAATTTGCAAAAACATGTG TTGCTGATGAGTCAGCTGAAAATTGTGACAAATCACTTCATACCCTTTTTGGAGACAAATTATGCACAGTTGCAACTCTT CGTGAAACCTATGGTGAAATGGCTGACTGCTGTGCAAAACAAGAACCTGAGAGAAATGAATGCTTCTTGCAACACAAAGA TGACAATCCAAATCTCCCCCGATTGGTGAGACCAGAGGTTGATGTGATGTGCACTGCTTTTCATGACAATGAAGAGACAT TTTTGAAAAAATACTTATATGAAATTGCCAGAAGACATCCTTACTTTTATGCCCCGGAACTCCTTTTCTTTGCTAAAAGG TATAAAGCTGCTTTTACAGAATGTTGCCAAGCTGCTGATAAAGCAGCCTGCCTGTTGCCAAAGCTCGATGAACTTCGGGA TGAAGGGAAGGCTTCGTCTGCCAAACAGAGACTCAAGTGTGCCAGTCTCCAAAAATTTGGAGAAAGAGCTTTCAAAGCAT GGGCAGTAGCTCGCCTGAGCCAGAGATTTCCCAAAGCTGAGTTTGCAGAAGTTTCCAAGTTAGTGACAGATCTTACCAAA GTCCACACGGAATGCTGCCATGGAGATCTGCTTGAATGTGCTGATGACAGGGCGGACCTTGCCAAGTATATCTGTGAAAA TCAAGATTCGATCTCCAGTAAACTGAAGGAATGCTGTGAAAAACCTCTGTTGGAAAAATCCCACTGCATTGCCGAAGTGG AAAATGATGAGATGCCTGCTGACTTGCCTTCATTAGCGGCTGATTTTGTTGAAAGTAAGGATGTTTGCAAAAACTATGCT GAGGCAAAGGATGTCTTCTTGGGCATGTTTTTGTATGAATATGCAAGAAGGCATCCTGATTACTCTGTCGTACTGCTGCT GAGACTTGCCAAGACATATGAAACCACTCTAGAGAAGTGCTGTGCCGCTGCAGATCCTCATGAATGCTATGCCAAAGTGT TCGATGAATTTAAACCTCTTATGGAAGAGCCTCAGAATTTAATCAAACAAAATTGTGAGCTTTTTGAGCAGCTTGGAGAG TACAAATTCCAGAATGCGCTATTAGTTCGTTACACCAAGAAAGTACCCCAAGTGTCAACTCCAACTCTTGTAGAGGTCTC AAGAAACCTAGGAAAAGTGGGCAGCAAATGTTGTAAACATCCTGAAGCAAAAAGAATGCCCTGTGCAGAAGACTATCTAT CCGTGGTCCTGAACCAGTTATGTGTGTTGCATGAGAAAACGCCAGTAAGTGACAGAGTCACCAAATGCTGCACAGAATCC TTGGTGAACAGGCGACCATGCTTTTCAGCTCTGGAAGTCGATGAAACATACGTTCCCAAAGAGTTTAATGCTGAAACATT CACCTTCCATGCAGATATATGCACACTTTCTGAGAAGGAGAGACAAATCAAGAAACAAACTGCACTTGTTGAGCTTGTGA AACACAAGCCCAAGGCAACAAAAGAGCAACTGAAAGCTGTTATGGATGATTTCGCAGCTTTTGTAGAGAAGTGCTGCAAG GCTGACGATAAGGAAACCTGCTTTGCCGAGGAGGGTAAAAAACTTGTTGCTGCAAGTCAAGCTGCCTTAGGCTTAAA
Ac_5_flank AACGGCTCCGCCCACTATTAATGAAATTAAAAATTCCAATTTTAAAAAACGCAGCAAGAGAAACATTTGTATGAAAGAAT GCGTAGAAGGAAAGAAAAATGTCGTCGACATGCTGAACAACAAGATTAATATGCCTCCGTGTATAAAAAAAATATTGAAC GATTTGAAAGAAAACAATGTACCGCGCGGCGGTATGTACAGGAAGAGGTTTATACTAAACTGTTACATTGCAAACGTGGT TTCGTGTGCCAAGTGTGAAAACCGATGTTTAATCAAGGCTCTGACGCATTTCTACAACCACGACTCCAAGTGTGTGGGTG AAGTCATGCATCTTTTAATCAAATCCCAAGATGTGTATAAACCACCAAACTGCCAAAAAATGAAAACTGTCGACAAGCTC TGTCCGTTTGCTGGCAACTGCAAGGGTCTCAATCCTATTTGTAATTATTGAATAATAAAACAATTATAAATGCTAAATTT GTTTTTTATTAACGATACAAACCAAACGCAACAAGAACATTTGTAGTATTATCTATAATTGAAAACGCGTAGTTATAATC GCTGAGGTAATATTTAAAATCATTTTCAAATGATTCACAGTTAATTTGCGACAATATAATTTTATTTTCACATAAACTAG ACGCCTTGTCGTCTTCTTCTTCGTATTCCTTCTCTTTTTCATTTTTCTCCTCATAAAAATTAACATAGTTATTATCGTAT CCATATATGTATCTATCGTATAGAGTAAATTTTTTGTTGTCATAAATATATATGTCTTTTTTAATGGGGTGTATAGTACC GCTGCGCATAGTTTTTCTGTAATTTACAACAGTGCTATTTTCTGGTAGTTCTTCGGAGTGTGTTGCTTTAATTATTAAAT TTATATAATCAATGAATTTGGGATCGTCGGTTTTGTACAATATGTTGCCGGCATAGTACGCAGCTTCTTCTAGTTCAATT ACACCATTTTTTAGCAGCACCGGATTAACATAACTTTCCAAAATGTTGTACGAACCGTTAAACAAAAACAGTTCACCTCC CTTTTCTATACTATTGTCTGCGAGCAGTTGTTTGTTGTTAAAAATAACAGCCATTGTAATGAGACGCACAAACTAATATC ACAAACTGGAAATGTCTATCAATATAT
Ac_3_flank GTTATTAGTACATTTATTAAGCGCTAGATTCTGTGCGTTGTTGATTTACAGACAATTGTTGTACGTATTTTAATAATTCA TTAAATTTATAATCTTTAGGGTGGTATGTTAGAGCGAAAATCAAATGATTTTCAGCGTCTTTATATCTGAATTTAAATAT TAAATCCTCAATAGATTTGTAAAATAGGTTTCGATTAGTTTCAAACAAGGGTTGTTTTTCCGAACCGATGGCTGGACTAT CTAATGGATTTTCGCTCAACGCCACAAAACTTGCCAAATCTTGTAGCAGCAATCTAGCTTTGTCGATATTCGTTTGTGTT TTGTTTTGTAATAAAGGTTCGACGTCGTTCAAAATATTATGCGCTTTTGTATTTCTTTCATCACTGTCGTTAGTGTACAA TTGACTCGACGTAAACACGTTAAATAAAGCTTGGACATATTTAACATCGGGCGTGTTAGCTTTATTAGGCCGATTATCGT CGTCGTCCCAACCCTCGTCGTTAGAAGTTGCTTCCGAAGACGATTTTGCCATAGCCACACGACGCCTATTAATTGTGTCG GCTAACACGTCCGCGATCAAATTTGTAGTTGAGCTTTTTGGAATTATTTCTGATTGCGGGCGTTTTTGGGCGGGTTTCAA TCTAACTGTGCCCGATTTTAATTCAGACAACACGTTAGAAAGCGATGGTGCAGGCGGTGGTAACATTTCAGACGGCAAAT CTACTAATGGCGGCGGTGGTGGAGCTGATGATAAATCTACCATCGGTGGAGGCGCAGGCGGGGCTGGCGGCGGAGGCGGA GGCGGAGGTGGTGGCGGTGATGCAGACGGCGGTTTAGGCTCAAATGTCTCTTTAGGCAACACAGTCGGCACCTCAACTAT TGTACTGGTTTCGGGCGCCGTTTTTGGTTTGACCGGTCTGAGACGAGTGCGATTTTTTTCGTTTCTAATAGCTTCCAACA ATTGTTGTCTGTCGTCTAAAGGTGCAGCGGGTTGAGGTTCCGTCGGCATTGGTGGAGCGGGCGGCAATTCAGACATCGAT GGTGGTGGTGGTGGTGGAGGCGCTGGAATGTTAGGCACGGGAGAAGGTGGTGGCGGCGGTGCCGCCGGTATAATTTGTTC TGGTTTAGTTTGTTCGCGCACGATTGTGGGCACCGGCGCAGGCGCCGCTGGCTGCACAACGGAAGGTCGTCTGCTTCGAG GCAGCGCTTGGGGTGGTGGCAATTCAATATTATAATTGGAATACAAATCGTAAAAATCTGCTATAAGCATTGTAATTTCG CTATCGTTTACCGTGCCGATATTTAACAACCGCTCAATGTAAGCAATTGTATTGTAAAGAGATTGTCTCAAGCTCGGATC GATCCCGCACGCCGATAACAAGCCTTTTCATTTTTACTACAGCATTGTAGTGGCGAGACACTTCGCTGTCGTCG
casp-3 AAGAGGAAGGGCGACGAGGTGGACGGCGTGGACGAG
MODC AGCCATGGCTTCCCGCCGGAGGTGGAGGAGCAGGATGATGGCACGCTGCCCATGTCTTGTGCCCAGGAGAGCGGGATGGA CCGTCACCCTGCAGCCTGTGCTTCTGCTAGGATCAATGTGTAG
MODC GTCACGGCCAATGTGGCAACTCATGAAACAGATCCAGAGCCATGGCTTCCCGCCGGAGGTGGAGGAGCAGGATGATGGCA CGCTGCCCATGTCTTGTGCCCAGGAGAGCGGGATGGACCGTCACCCTGCAGCCTGTGCTTCTGCTAGGATCAATGTGTAG
CEN4 CGCTGGGCCATTCTCATGAAGAATATCTTGAATTTATTGTCATATTACTAGTTGGTGTGGAAGTCCATATATCGGTGATC AATATAGTGGTTGACATGCTGGCTAGTCAACATTGAGCCTTTTGATCATGCAAATATATTACGGTATTTTACAATCAAAT ATCAAACTTAACTATTGACTTTATAACTTATTTAGGTGGTAACATTCTTATAAAAAAGAAAAAAATTACTGCAAAACAGT ACTAGCTTTTAACTTGTATCCTAGGTTATCTATGCTGTCTCACCATAGAGAATATTACCTATTTCAGAATGTATGTCCAT GATTCGCCGGGTAAATACATATAATACACAAATCTGGCTTAATAAAGTCTATAATATATCTCATAAAGAAGTGCTAAATT GGCTAGTGCTATATATTTTTAAGAAAATTTCTTTTGACTAAGTCCATATCGACTTTGTAAAAGTTCACTTTAGCATACAT ATATTACACGAGCCAGAAATTGTAACTTTTGCCTAAAATCACAAATTGCAAAATTTAATTGCTTGCAAAAGGTCACATGC TTATAATCAACTTTTTTAAAAATTTAAAATACTTTTTTATTTTTTATTTTTAAACATAAATGAAATAATTTATTTATTGT TTATGATTACCGAAACATAAAACCTGCTCAAGAAAAAGAAACTGTTTTGTCCTTGGAAAAAAAGCACTACCTAGGAGCGG CCAAAATGCCGAGGCTTTCATAGCTTAAACTCTTTACAGAAAATAGGCATTATAGATCAGTTCGAGTTTTCTTATTCTTC CTTCCGGTTTTATCGTCACAGTTTTACAGTAAATAAGTATCACCTCTTAGAGT
CEN6_ARS4 GGTCCTTTTCATCACGTGCTATAAAAATAATTATAATTTAAATTTTTTAATATAAATATATAAATTAAAAATAGAAAGTA AAAAAAGAAATTAAAGAAAAAATAGTTTTTGTTTTCCGAAGATGTAAAAGACTCTAGGGGGATCGCCAACAAATACTACC TTTTATCTTGCTCTTCCTGCTCTCAGGTATTAATGCCGAATTGTTTCATCTTGTCTGTGTAGAAGACCACACACGAAAAT CCTGTGATTTTACATTTTACTTATCGTTAATCGAATGTATATCTATTTAATCTGCTTTTCTTGTCTAATAAATATATATG TAAAGTACGCTTTTTGTTGAAATTTTTTAAACCTTTGTTTATTTTTTTTTCTTCATTCCGTAACTCTTCTACCTTCTTTA TTTACTTTCTAAAATCCAAATACAAAACATAAAAATAAATAAACACAGAGTAAATTCCCAAATTATTCCATCATTAAAAG ATACGAGGCGCGTGTAAGTTACAGGCAAGCGATCCGTCC
M13_reverse_primer GGAAACAGCTATGACCATG
M13_forward20_primer GTAAAACGACGGCCAGT
Sp6_primer ATTTAGGTGACACTATAG
BGHrev_primer TAGAAGGCACAGTCGAGG
GFPfusionREV_primer CTCCACTGACAGAAAATTTG
MSCV_rev_primer CAGCGGGGCTGCTAAAGCGCATGC
pBluescriptSK_primer TCTAGAACTAGTGGATC
pBluescriptKS_primer TCGAGGTCGACGGTATC
pGEX_3_primer CCGGGAGCTGCATGTGTCAGAGG
pGEX_5_primer GGGCTGGCAAGCCACGTTTGGTG
T7_Terminal_primer GCTAGTTATTGCTCAGCGG
3_AOX1_primer GCAAATGGCATTCTGACATCC
5_AOX1_primer GACTGGTCCAATTGACAAGC
AC5_primer ACACAAAGCCGCTCCATCAG
AUG1_fwd_primer CAATTTACATCTTTATTTATTAACG
AUG1_rev_primer GAAGAGAAAAACATTAGTTGGC
BGH_rev_primer TAGAAGGCACAGTCGAGG
Baculovirs_rev_primer ACTTCAAGGAGAATTTCC
CMV_fwd_primer CGCAAATGGGCGGTAGGCGTG
CYC1_primer GCGTGAATGTAAGCGTGAC
EBV_rev_primer GTGGTTTGTCCAAACTCATC
EF1a_fwd_primer TCAAGCCTCAGACAGTGGTTC
Ecdysone_fwd_primer CTCTGAATACTTTCAACAAGTTAC
GAL1_primer AATATACCTCTATACTTTAACGTC
M13_pUC_fwd_primer CCCAGTCACGACGTTGTAAAACG
M13_pUC_rev_primer AGCGGATAACAATTTCACACAGG
Metallothionein_primer CATCTCAGTGCAACTAAA
OpIE2_fwd_primer CGCAACGATCTGGTAAACAC
V5_rev_primer ACCGAGGAGAGGGTTAGGAT
Xpress_fwd_primer TATGGCTAGCATGACTGGT
alpha_factor_primer TACTATTGCCAGCATTGCTGC
cI_fwd_primer GGATAGCCGGTCAGGTGTT
pBAD_fwd_primer ATGCCATAGCATTTTTATCC
pBAD_rev_primer GATTTAATCTGTATCAGG
pCEP_fwd_primer AGAGCTCGTTTAGTGAACCG
pGAP_primer GTCCCTATTTCAATCAATTGAA
pGENE_fwd_primer CTGCTATTCTGCTCAACCT
pHybLex_fwd_primer AGGGCTGGCGGTTGGGGTTATTCGC
pHybLex_rev_primer GAGTCACTTTAAAATTTGTATACAC
pJG4_5_fwd_primer GATGCCTCCTACCCTTATGATGTGCC
pJG4_5_rev_primer GGAGACTTGACCAAACCTCTGGCG
pREP_fwd_primer GCTCGATACAATAAACGCC
pRH_fwd_primer CTGTCTCTATACTCCCCTATAG
pRH_rev_primer CAAAATTCAATAGTTACTATCGC
pTrcHis_fwd_primer GAGGTATATATTAATGTATCG
pTrcHis_rev_primer GATTTAATCTGTATCAGG
pUni_fwd_primer CTATCAACAGGTTGAACTG
pUni_rev_primer CAGTCGAGGCTGATAGCGAGCT
pYESTrp_fwd_primer GATGTTAACGATACCAGCC
pYESTrp_rev_primer GCGTGAATGTAAGCGTGAC
polyhedrin_fwd_primer AAATGATAACCATCTCGC
polyhedrinn_rev_primer GTCCAAGTTTCCCTG
EGFP_C_primer CATGGTCCTGCTGGAGTTCGTG
EGFP_N_primer CGTCGCCGTCCAGCTCGACCAG
GAL1_primer AATATACCTCTATACTTTAACGTC
Gal4_AD_primer AATACCACTACAATGGAT
HA_primer ATGTACCCATACCATGTTCCAGATTAC
HAT_primer GAGGAGCACGCTCATGCCCAC
LNCX_primer AGCTCGTTTAGTGAACCGTCAGATC
MSCV_primer CCCTTGAACCTCCTCGTTCGACC
Myc_primer GCATCAATGCAGAAGCTGATCTCA
dsRed_primer GTACTGGAACTGGGGGGACAG
pCMV_primer GATCCGGTACTAGAGGAACTGAAAAAC
GFP_R_primer CCATCTAATTCAACAAGAATTGGGACAAC
Gal4_N_term_primer GAGTAGTAACAAAGGTCAA
HA_F_primer TACCCATACGACGTCCCAGA
HA_R_primer TCTGGGACGTCGTATGGGTA
LKO1_5_primer GACTATCATATGCTTACCGT
LucNrev_primer CCTTATGCAGTTGCTCTCC
pBABE_3_primer ACCCTAACTGACACACATTCC
pBABE_5_primer CTTTATCCAGCCCTCAC
pBMN_5_primer GCTTGGATACACGCCGC
pBRrevBam_primer GGTGATGTCGGCGATATAGG
pLXSN_5_primer CCCTTGAACCTCCTCGTTCGACC
RVprimer3_primer CTAGCAAAATAGGCTGTCCC
SV40pro_F_primer TATTTATGCAGAGGCCGAGG

Reference:
A portion of the sequences on this page were obtained from the PlasMapper website. See Xiaoli Dong, Paul Stothard, Ian J. Forsythe, and David S. Wishart, PlasMapper: a web server for drawing and auto-annotating plasmid maps, Nucleic Acids Res. 2004 Jul 1;32(Web Server issue):W660-4. (PubMed)