COMMONLY USED PRIMERS:

CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen)
Human CMV immediate early promoter, forward primer
LKO.1 5'GACTATCATATGCTTACCGT (Weinberg Lab)
Human U6 promoter, forward primer
LucNrevCCTTATGCAGTTGCTCTCC
5' end of luciferase, reverse primer
M13 ReverseCAGGAAACAGCTATGAC
In lacZ gene
MSCVCCCTTGAACCTCCTCGTTCGACC (BD Biosciences)
Murine stem cell virus, forward primer
pBABE 5'CTTTATCCAGCCCTCAC (Weinberg Lab)
Psi packaging signal, 5' of MCS in pBABE vectors, forward primer
pGEX 5'GGGCTGGCAAGCCACGTTTGGTG
3' end of glutathione-S-transferase, forward primer
SP6ATTTAGGTGACACTATAG
SP6 promoter, forward primer
T3GCAATTAACCCTCACTAAAGG
T3 promoter, forward primer
T7TAATACGACTCACTATAGGG
T7 promoter, forward primer

                                                                                          

COMPLETE LIST:

3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen)
For Pichia vectors with AOX1 terminator, reverse primer
5'AOX1GACTGGTTCCAATTGACAAGC (Invitrogen)
For Pichia vectors with AOX1 promoter, forward primer
35S promoterCTATCCTTCGCAAGACCCTTC
CaMV 35S promoter, forward primer
AC5ACACAAAGCCGCTCCATCAG (Invitrogen)
Drosophila Actin 5C promoter, forward primer
Alpha-factorTACTATTGCCAGCATTGCTGC (Invitrogen)
Alpha factor signal sequence, forward primer
Amp-RATAATACCGCGCCACATAGC
5' end of ampicillin resistance gene, reverse primer
AUG1 ForwardCAATTTACATCTTTATTTATTAACG (Invitrogen)
For Pichia vectors with AUG1 promoter, forward primer
AUG1 ReverseGAAGAGAAAAACATTAGTTGGC (Invitrogen)
For Pichia vectors with AUG1 promoter, reverse primer
BGH ReverseTAGAAGGCACAGTCGAGG (Invitrogen)
Bovine growth hormone terminator, reverse primer
Bglob-intron-FCTGGTCATCATCCTGCCTTT
Rabbit beta-globin intron, forward primer
Bglob-intron-RTTTGCCCCCTCCATATAACA
Rabbit beta-globin intron, reverse primer
Bglob-pA-RTTTTGGCAGAGGGAAAAAGA
Rabbit beta-globin polyA region, reverse primer
CAT-RGCAACTGACTGAAATGCCTC
5' end of chloramphenicol resistance gene, reverse primer
CMV ForwardCGCAAATGGGCGGTAGGCGTG (Invitrogen)
Human CMV immediate early promoter, forward primer
CRE-RGCAAACGGACAGAAGCATTT
5' end of Cre recombinase, reverse primer
CYC1GCGTGAATGTAAGCGTGAC (Invitrogen)
CYC1 transcription termination signal, reverse primer
DsRed1-CAGCTGGACATCACCTCCCACAACG (BD Biosciences)
3' end of DsRed1, forward primer
DsRed1-NGTACTGGAACTGGGGGGACAG (BD Biosciences)
5' end of DsRed1, reverse primer
EBV ReverseGTGGTTTGTCCAAACTCATC (Invitrogen)
SV40 polyA terminator, reverse primer
Ecdysone ForwardCTCTGAATACTTTCAACAAGTTAC (Invitrogen)
Drosophila heat shock promoter, forward primer
EF-1a ForwardTCAAGCCTCAGACAGTGGTTC (Invitrogen)
Human elongation factor-1a promoter, forward primer
EGFP-CCATGGTCCTGCTGGAGTTCGTG (BD Biosciences)
3' end of EGFP, forward primer
EGFP-NCGTCGCCGTCCAGCTCGACCAG (BD Biosciences)
5' end of EGFP, reverse primer
EXFP-RGTCTTGTAGTTGCCGTCGTC (Golenbock lab)
For distinguishing EGFP vs ECFP vs EYFP, reverse primer
GAL1AATATACCTCTATACTTTAACGTC (Invitrogen)
S. cerevisiae GAL1 promoter, forward primer
Gal10pro-FGGTGGTAATGCCATGTAATATG (Stratagene)
S. cerevisiae GAL10 promoter, forward primer
Gal4 N-termGAGTAGTAACAAAGGTCAA
3' end of Gal4 DNA binding domain, forward primer
Gal4-ADAATACCACTACAATGGAT (BD Biosciences)
3' end of Gal4 activation domain, forward primer
GFP-FGGTCCTTCTTGAGTTTGTAAC
3' end of GFP, forward primer
GFP-RCCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab)
5' end of GFP, reverse primer
GPDpro-FCGGTAGGTATTGATTGTAATTCTG
S. cerevisiae GPD promoter, forward primer
GW-3'GCATGATGACCACCGATATG
3' end of Gateway cassette, forward primer
GW-5'AATCTCGCCGGATCCTAACT
5' end of Gateway cassette, reverse primer
H1TCGCTATGTGTTCTGGGAAA
Human H1 promoter, forward primer
HA-FTACCCATACGACGTCCCAGA
HA tag, forward primer
HA-RTCTGGGACGTCGTATGGGTA
HA tag, reverse primer
HATGAGGAGCACGCTCATGCCCAC (BD Biosciences)
Histidine affinity tag, forward primer
hGH-PA-RCCAGCTTGGTTCCCAATAGA
Human growth hormone terminator, reverse primer
hrGFP-RTCCCCGAGTACCACTTCATC
hrGFP (humanized Renilla GFP), forward primer
hUBCpro-FTGAAGCTCCGGTTTTGAACT
Human Ubiquitin C (UbC) promoter, forward primer
IRES-FTGGCTCTCCTCAAGCGTATT
3' end of IRES, forward primer
IRES-RCCTCACATTGCCAAAAGACG
5' end of IRES, reverse primer
L4440AGCGAGTCAGTGAGCGAG (Caldwell lab)
5' of MCS in L4440 vector, forward primer
LacI-RGGCATACTCTGCGACATCGT
5' end of LacI, reverse primer
LacZ-RGACAGTATCGGCCTCAGGAA
5' end of LacZ, reverse primer
LexACGTCAGCAGAGCTTCACCATTG (Caldwell lab)
3' end of LexA DNA binding domain, forward primer
LKO.1 5'GACTATCATATGCTTACCGT (Weinberg Lab)
Human U6 promoter, forward primer
LNCXAGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences)
Human CMV promoter, forward primer
Luc-FAGTCAAGTAACAACCGCGA
3' end of luciferase, forward primer
LucNrevCCTTATGCAGTTGCTCTCC
5' end of luciferase, reverse primer
M13 (-21) ForwardTGTAAAACGACGGCCAGT
In lacZ gene
M13 (-40)GTTTTCCCAGTCACGAC
In lacZ gene
M13 ReverseCAGGAAACAGCTATGAC
In lacZ gene
M13/pUC ForwardCCCAGTCACGACGTTGTAAAACG (Invitrogen)
In lacZ gene
M13/pUC ReverseAGCGGATAACAATTTCACACAGG (Invitrogen)
In lacZ gene
MBP-FGATGAAGCCCTGAAAGACGCGCAG (Waugh lab)
3' end of maltose binding protein, forward primer
MT ForwardCATCTCAGTGCAACTAAA (Invitrogen)
Drosophila metallothionein promoter, forward primer
MMLV-FATCAGTTCGCTTCTCGCTTC
Moloney murine leukemia virus LTR (MoMuLV), forward primer
mPGK-FCATTCTGCACGCTTCAAAAG
Mouse PGK promoter, forward primer
MSCVCCCTTGAACCTCCTCGTTCGACC (BD Biosciences)
Murine stem cell virus, forward primer
MSCV-revCAGCGGGGCTGCTAAAGCGCATGC
Murine stem cell virus, reverse primer
MT1-FGCTGTCCTCTAAGCGTCACC
Mouse metallothionein 1 promoter, forward primer
mU6-FCAGCACAAAAGGAAACTCACC
Mouse U6 promoter, forward primer
MycGCATCAATGCAGAAGCTGATCTCA (BD Biosciences)
Myc tag, forward primer
Neo-FCGTTGGCTACCCGTGATATT
3' end of neomycin resistance gene, forward primer
Neo-RGCCCAGTCATAGCCGAATAG
5' end of neomycin resistance gene, reverse primer
NOS-FGCGTTCAAAAGTCGCCTAAG
Nopaline synthase promoter, forward primer
Nmt1-FGCAATGTGCAGCGAAACTAA
S. pombe nmt1 promoter, forward primer
OpIE2 ForwardCGCAACGATCTGGTAAACAC (Invitrogen)
OpIE2 promoter, forward primer
pACYC-FTGAAGTCAGCCCCATACGAT
p15A origin, forward primer
pAd-CMVGCTAGAGATCTGGTACCGTC
For cloning sites after SalI in pAd-CMV vector
pBABE 3'ACCCTAACTGACACACATTCC (Weinberg Lab)
SV40 enhancer, 3' of MCS in pBABE vectors, reverse primer
pBABE 5'CTTTATCCAGCCCTCAC (Weinberg Lab)
Psi packaging signal, 5' of MCS in pBABE vectors, forward primer
pBAD ForwardATGCCATAGCATTTTTATCC (Invitrogen)
For vectors with E. coli araBAD promoter, forward primer
pBAD ReverseGATTTAATCTGTATCAGG (Invitrogen)
For vectors with E. coli araBAD promoter, reverse primer
pBluescriptKSTCGAGGTCGACGGTATC
For pBluescript vector
pBluescriptSKTCTAGAACTAGTGGATC
For pBluescript vector
pBMN 5'GCTTGGATACACGCCGC
MMLV sequence, for inserts in pBMN retroviral vector
pBRforBamCTTGGAGCCACTATCGAC
In pBR322 tet region, upstream of BamHI, forward primer
pBRforEcoAATAGGCGTATCACGAGGC
In pBR322, upsteam of EcoRI site, forward primer
pBRrevBamGGTGATGTCGGCGATATAGG
In pBR322 tet region, downstream of BamHI, reverse primer
pCAG-FGCAACGTGCTGGTTATTGTG
Rabbit beta-globin intron, for pCAG plasmids, forward primer
pCasper-FGGGTTTTATTAACTTACAT (Vosshall lab)
5' end of Drosophila mini-white gene, reverse primer
pCasper-hsGCAACTACTGAAATCTGCCAAG
Drosophila Hsp70 promoter, forward primer
pcDL-FGTTGCCTTTACTTCTAGGCCT (Kinet lab)
5' of EcoRI site in pcDL vector, forward primer
pENTR-FCTACAAACTCTTCCTGTTAGTTAG
5' of attL1 in pENTR vector, forward primer
pENTR-RATGGCTCATAACACCCCTTG
3' of attL2 in pENTR vector, reverse primer
pGEX 3'CCGGGAGCTGCATGTGTCAGAGG
3' of MCS in pGEX vectors, reverse primer
pGEX 5'GGGCTGGCAAGCCACGTTTGGTG
3' end of glutathione-S-transferase, forward primer
pGP704-RAACAAGCCAGGGATGTAACG
R6K gamma origin, 3' of MCS in pGP704 vector, reverse primer
pHybLex ReverseGAGTCACTTTAAAATTTGTATACAC (Invitrogen)
ADH terminator, reverse primer
pLTet-FACTGAGCACATCAGCAGGAC
Lambda phage early leftward (pL) promoter, forward primer
pLXSN 5'CCCTTGAACCTCCTCGTTCGACC (MSCV)
Murine stem cell virus, same as MSCV, forward primer
pMRB101-FAAGATGCAGGCAGCTGAGTT
HCMV major immediate-early protein (IE), forward primer
pMT2-FTTGCCTTTCTCTCCACAGGT
3' end of synthetic intron, forward primer
pMX-S1811GACGGCATCGCAGCTTGGATACAC (Yamanaka lab)
MMLV sequence, 5' of MCS in pMXs vector, forward primer
Polyhedrin forwardAAATGATAACCATCTCGC (Invitrogen)
Polyhedrin promoter, forward primer
Polyhedrin reverseGTCCAAGTTTCCCTG (Invitrogen)
For baculovirus vector with polyhedrin promoter, reverse primer
pQE promoterCCCGAAAAGTGCCACCTG (Qiagen)
5' of MCS in pQE vectors, forward primer
pREP ForwardGCTCGATACAATAAACGCC (Invitrogen)
Rous sarcoma virus (RSV) promoter, forward primer
pRS-markerCGGCATCAGAGCAGATTGTA
To sequence yeast selectable marker in pRS vectors
Pry1CTTAGCATGTCCGTGGGGTTTGAAT
PZ P-element, reverse primer
pTrcHis ForwardGAGGTATATATTAATGTATCG (Invitrogen)
5' of MCS in pTrcHis vector, forward primer
pTrcHis ReverseGATTTAATCTGTATCAGG (Invitrogen)
3' of MCS in pTrcHis vector, same as pBAD-R, reverse primer
Puro-FGCAACCTCCCTTCTACGAGC
3' end of puromycin resistance gene, forward primer
pZIPTCCTTTCCAGCGAGGTTCTA
Murine leukemia virus (MuLV), reverse primer
RCAS-FACATGGGTGGTGGTATAGCGCTTGCG (Orsulic lab)
3' of Rous sarcoma virus (RSV) env gene, forward primer
Rluc-FCCAGGATTCTTTTCCAATGC
3' end of Renilla luciferase, forward primer
RVprimer3CTAGCAAAATAGGCTGTCCC (Promega)
5' of MCS in pGL3 vector, forward primer
SFFV-FATTGATTGACTGCCCACCTC
Spleen focus forming virus 5' LTR, forward primer
SP6ATTTAGGTGACACTATAG
SP6 promoter, forward primer
SV40pA-RGAAATTTGTGATGCTATTGC
SV40 polyA, reverse primer
SV40pro-FTATTTATGCAGAGGCCGAGG
SV40 promoter/origin, forward primer
SV40-spliceRCACAAAGATCCGGACCAAAG
SV40 splice sequence, reverse primer
T3GCAATTAACCCTCACTAAAGG
T3 promoter, forward primer
T7TAATACGACTCACTATAGGG
T7 promoter, forward primer
T7 TerminalGCTAGTTATTGCTCAGCGG
T7 terminator, reverse primer
Tac promoterGAGCGGATAACAATTTCACACAGG (Waugh lab)
Tac promoter, forward primer
Tet-RGGCGAGTTTACGGGTTGTTA
5' end of tetracycline resistance gene, reverse primer
TK-pA-RTTGTCTCCTTCCGTGTTTCA
Thymidine kinase polyA, reverse primer
Tn7-endGGGGTGGAAATGGAGTTTTT
Bacterial transposon Tn7
TRC-FCAAGGCTGTTAGAGAGATAATTGGA (Root lab)
Human U6 promoter, forward primer
Ubx-FAACTCGTACTTTGAACAGGC
Drosophila Ultrabithorax gene, forward primer
V5 ReverseACCGAGGAGAGGGTTAGGGAT (Invitrogen)
V5 epitope, reverse primer
WPRE-RCATAGCGTAAAAGGAGCAACA
5' end of WPRE, reverse primer
XBG-RGACTCCATTCGGGTGTTC
Xenopus beta-globin 3'UTR, reverse primer
XEF1aTTTCGCCCTAACTTCGTGAT
Xenopus EF1 alpha enhancer/promoter, forward primer
Xpress ForwardTATGGCTAGCATGACTGGT (Invitrogen)
Xpress epitope, forward primer